\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0120108656:

Variant ID: vg0120108656 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 20108656
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTCACATCTTTCGTCGGTCGGACGAATTCCACAATAGTCCCGGTTACAATAAAAACCGGGACTAAAGATGATCTTTAGTCCCGGTTAAAAAGGGTAATA[G/A]
GCATATTTAATCTTTAGTCCCGGTTGGTATCATCTTTAGTCCCGGTTCAAATGCTGTCAGGGCTTGTCAGGCCCTCATTAGCCCCGGTTTGTAACACCAA

Reverse complement sequence

TTGGTGTTACAAACCGGGGCTAATGAGGGCCTGACAAGCCCTGACAGCATTTGAACCGGGACTAAAGATGATACCAACCGGGACTAAAGATTAAATATGC[C/T]
TATTACCCTTTTTAACCGGGACTAAAGATCATCTTTAGTCCCGGTTTTTATTGTAACCGGGACTATTGTGGAATTCGTCCGACCGACGAAAGATGTGAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.60% 4.00% 4.44% 14.96% NA
All Indica  2759 61.00% 6.80% 6.92% 25.23% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 92.90% 0.00% 5.95% 1.12% NA
Indica I  595 29.70% 0.50% 9.92% 59.83% NA
Indica II  465 64.90% 0.00% 6.88% 28.17% NA
Indica III  913 78.60% 13.90% 2.96% 4.49% NA
Indica Intermediate  786 62.00% 7.40% 9.29% 21.37% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 88.90% 1.10% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0120108656 G -> A LOC_Os01g36280.1 upstream_gene_variant ; 985.0bp to feature; MODIFIER silent_mutation Average:46.944; most accessible tissue: Minghui63 young leaf, score: 76.82 N N N N
vg0120108656 G -> A LOC_Os01g36270-LOC_Os01g36280 intergenic_region ; MODIFIER silent_mutation Average:46.944; most accessible tissue: Minghui63 young leaf, score: 76.82 N N N N
vg0120108656 G -> DEL N N silent_mutation Average:46.944; most accessible tissue: Minghui63 young leaf, score: 76.82 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0120108656 NA 1.51E-09 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120108656 NA 1.09E-07 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120108656 NA 6.27E-07 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120108656 NA 9.68E-07 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120108656 NA 7.65E-11 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120108656 NA 7.02E-10 mr1980_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251