RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0120090794:

Variant ID: vg0120090794 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 20090794
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

CATAAAACCACAGCAGTACCTGTATATTCACCTATGAAATCCAGTCATCTCCAAAACCACTTCGTGAATAAATTCCAAATAACAAAACCAATAATCTCCA[T/A]
TGCACAATTGTTCATCACAGAATAATAATCAAAAACACCTTTGATTTTACATAGCTTTGGGCCTCGGCTGCCTACATGGTCCATGATCTCACGCCAAAAT

Reverse complement sequence

ATTTTGGCGTGAGATCATGGACCATGTAGGCAGCCGAGGCCCAAAGCTATGTAAAATCAAAGGTGTTTTTGATTATTATTCTGTGATGAACAATTGTGCA[A/T]
TGGAGATTATTGGTTTTGTTATTTGGAATTTATTCACGAAGTGGTTTTGGAGATGACTGGATTTCATAGGTGAATATACAGGTACTGCTGTGGTTTTATG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.90%	10.10%	8.23%	14.85%	NA
All Indica	2759	64.30%	1.70%	8.92%	25.05%	NA
All Japonica	1512	65.40%	27.10%	7.47%	0.00%	NA
Aus	269	87.40%	1.50%	9.67%	1.49%	NA
Indica I	595	26.20%	1.70%	12.77%	59.33%	NA
Indica II	465	55.30%	3.20%	13.33%	28.17%	NA
Indica III	913	93.40%	0.10%	1.86%	4.60%	NA
Indica Intermediate	786	64.60%	2.80%	11.58%	20.99%	NA
Temperate Japonica	767	43.30%	46.00%	10.69%	0.00%	NA
Tropical Japonica	504	95.20%	2.00%	2.78%	0.00%	NA
Japonica Intermediate	241	73.40%	19.50%	7.05%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	73.30%	14.40%	4.44%	7.78%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0120090794	T -> A	LOC_Os01g36260.1	downstream_gene_variant ; 3223.0bp to feature; MODIFIER	silent_mutation	Average:50.82; most accessible tissue: Minghui63 flower, score: 76.149	N	N	N	N
vg0120090794	T -> A	LOC_Os01g36250-LOC_Os01g36260	intergenic_region ; MODIFIER	silent_mutation	Average:50.82; most accessible tissue: Minghui63 flower, score: 76.149	N	N	N	N
vg0120090794	T -> DEL	N	N	silent_mutation	Average:50.82; most accessible tissue: Minghui63 flower, score: 76.149	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0120090794	NA	6.34E-11	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0120090794	NA	4.80E-08	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120090794	NA	2.64E-14	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120090794	NA	2.63E-09	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120090794	NA	3.13E-12	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120090794	NA	4.13E-06	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120090794	8.23E-06	5.79E-15	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120090794	NA	2.97E-09	mr1056	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120090794	NA	1.23E-11	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120090794	NA	4.40E-06	mr1708	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 16 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0120090794:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact