\
| Variant ID: vg0120090794 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 20090794 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 93. )
CATAAAACCACAGCAGTACCTGTATATTCACCTATGAAATCCAGTCATCTCCAAAACCACTTCGTGAATAAATTCCAAATAACAAAACCAATAATCTCCA[T/A]
TGCACAATTGTTCATCACAGAATAATAATCAAAAACACCTTTGATTTTACATAGCTTTGGGCCTCGGCTGCCTACATGGTCCATGATCTCACGCCAAAAT
ATTTTGGCGTGAGATCATGGACCATGTAGGCAGCCGAGGCCCAAAGCTATGTAAAATCAAAGGTGTTTTTGATTATTATTCTGTGATGAACAATTGTGCA[A/T]
TGGAGATTATTGGTTTTGTTATTTGGAATTTATTCACGAAGTGGTTTTGGAGATGACTGGATTTCATAGGTGAATATACAGGTACTGCTGTGGTTTTATG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.90% | 10.10% | 8.23% | 14.85% | NA |
| All Indica | 2759 | 64.30% | 1.70% | 8.92% | 25.05% | NA |
| All Japonica | 1512 | 65.40% | 27.10% | 7.47% | 0.00% | NA |
| Aus | 269 | 87.40% | 1.50% | 9.67% | 1.49% | NA |
| Indica I | 595 | 26.20% | 1.70% | 12.77% | 59.33% | NA |
| Indica II | 465 | 55.30% | 3.20% | 13.33% | 28.17% | NA |
| Indica III | 913 | 93.40% | 0.10% | 1.86% | 4.60% | NA |
| Indica Intermediate | 786 | 64.60% | 2.80% | 11.58% | 20.99% | NA |
| Temperate Japonica | 767 | 43.30% | 46.00% | 10.69% | 0.00% | NA |
| Tropical Japonica | 504 | 95.20% | 2.00% | 2.78% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.40% | 19.50% | 7.05% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 14.40% | 4.44% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0120090794 | T -> A | LOC_Os01g36260.1 | downstream_gene_variant ; 3223.0bp to feature; MODIFIER | silent_mutation | Average:50.82; most accessible tissue: Minghui63 flower, score: 76.149 | N | N | N | N |
| vg0120090794 | T -> A | LOC_Os01g36250-LOC_Os01g36260 | intergenic_region ; MODIFIER | silent_mutation | Average:50.82; most accessible tissue: Minghui63 flower, score: 76.149 | N | N | N | N |
| vg0120090794 | T -> DEL | N | N | silent_mutation | Average:50.82; most accessible tissue: Minghui63 flower, score: 76.149 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0120090794 | NA | 6.34E-11 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0120090794 | NA | 4.80E-08 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120090794 | NA | 2.64E-14 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120090794 | NA | 2.63E-09 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120090794 | NA | 3.13E-12 | mr1034 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120090794 | NA | 4.13E-06 | mr1034 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120090794 | 8.23E-06 | 5.79E-15 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120090794 | NA | 2.97E-09 | mr1056 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120090794 | NA | 1.23E-11 | mr1650 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120090794 | NA | 4.40E-06 | mr1708 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120090794 | NA | 1.95E-12 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120090794 | NA | 1.10E-08 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120090794 | 2.38E-06 | 7.01E-18 | mr1013_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120090794 | NA | 4.14E-09 | mr1013_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120090794 | NA | 1.32E-16 | mr1031_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120090794 | NA | 7.10E-10 | mr1031_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |