Variant ID: vg0120050864 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 20050864 |
Reference Allele: A | Alternative Allele: C |
Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 263. )
TCAAAAATCCTCTAATCCGGATAAGGCCTTAAAAAGAGATAAATCCAATTTGGTCACTATGAAATCAGTTACAATTGGACTTGAACTCTCGAAATCGTCC[A/C]
TATTTCATCCTTGCGCTCAAATAAAGATGGTTTTGATGATGTGGCCTCATGTGGCAAAACAAAATTAACGAACATAGGTAGGATACAAGTACGAGAAGAA
TTCTTCTCGTACTTGTATCCTACCTATGTTCGTTAATTTTGTTTTGCCACATGAGGCCACATCATCAAAACCATCTTTATTTGAGCGCAAGGATGAAATA[T/G]
GGACGATTTCGAGAGTTCAAGTCCAATTGTAACTGATTTCATAGTGACCAAATTGGATTTATCTCTTTTTAAGGCCTTATCCGGATTAGAGGATTTTTGA
Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 87.10% | 11.30% | 1.57% | 0.00% | NA |
All Indica | 2759 | 97.90% | 1.40% | 0.62% | 0.00% | NA |
All Japonica | 1512 | 67.10% | 29.60% | 3.31% | 0.00% | NA |
Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
Indica I | 595 | 99.70% | 0.20% | 0.17% | 0.00% | NA |
Indica II | 465 | 98.10% | 1.30% | 0.65% | 0.00% | NA |
Indica III | 913 | 97.40% | 2.30% | 0.33% | 0.00% | NA |
Indica Intermediate | 786 | 97.20% | 1.50% | 1.27% | 0.00% | NA |
Temperate Japonica | 767 | 90.20% | 6.00% | 3.78% | 0.00% | NA |
Tropical Japonica | 504 | 26.20% | 70.20% | 3.57% | 0.00% | NA |
Japonica Intermediate | 241 | 79.30% | 19.50% | 1.24% | 0.00% | NA |
VI/Aromatic | 96 | 60.40% | 37.50% | 2.08% | 0.00% | NA |
Intermediate | 90 | 81.10% | 14.40% | 4.44% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0120050864 | A -> C | LOC_Os01g36229-LOC_Os01g36240 | intergenic_region ; MODIFIER | silent_mutation | Average:54.953; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0120050864 | NA | 8.62E-07 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0120050864 | NA | 1.02E-06 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0120050864 | NA | 3.84E-10 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0120050864 | NA | 5.14E-08 | mr1642 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0120050864 | NA | 1.98E-11 | mr1864 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0120050864 | NA | 2.29E-06 | mr1039_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0120050864 | 4.64E-06 | NA | mr1065_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0120050864 | 6.75E-07 | NA | mr1068_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0120050864 | 3.06E-06 | NA | mr1200_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |