\
| Variant ID: vg0120024869 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 20024869 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 222. )
CTTAGCCATGCTTAGTTCAACTAGTACACAAAGGGGGAATCACATTAATGCATAGACTTTGATTATTGGCATAGCTTTGGATTAATGCCACCGCAATGGT[G/A]
CTAGTTAATTAAAATACACTATATGGTAGGCTGTGGGTGCATGGTTTTGCTAGTCGTGCCCATGACGATTAAGGATCGGTTTGCGGGATGCCCTGGAAGA
TCTTCCAGGGCATCCCGCAAACCGATCCTTAATCGTCATGGGCACGACTAGCAAAACCATGCACCCACAGCCTACCATATAGTGTATTTTAATTAACTAG[C/T]
ACCATTGCGGTGGCATTAATCCAAAGCTATGCCAATAATCAAAGTCTATGCATTAATGTGATTCCCCCTTTGTGTACTAGTTGAACTAAGCATGGCTAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.70% | 37.20% | 0.02% | 0.08% | NA |
| All Indica | 2759 | 36.60% | 63.20% | 0.04% | 0.14% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 15.60% | 84.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 62.60% | 37.00% | 0.00% | 0.43% | NA |
| Indica III | 913 | 30.80% | 69.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 44.00% | 55.60% | 0.13% | 0.25% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0120024869 | G -> A | LOC_Os01g36200.1 | upstream_gene_variant ; 1429.0bp to feature; MODIFIER | silent_mutation | Average:46.258; most accessible tissue: Minghui63 flag leaf, score: 66.004 | N | N | N | N |
| vg0120024869 | G -> A | LOC_Os01g36200-LOC_Os01g36220 | intergenic_region ; MODIFIER | silent_mutation | Average:46.258; most accessible tissue: Minghui63 flag leaf, score: 66.004 | N | N | N | N |
| vg0120024869 | G -> DEL | N | N | silent_mutation | Average:46.258; most accessible tissue: Minghui63 flag leaf, score: 66.004 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0120024869 | NA | 7.04E-10 | mr1195 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120024869 | NA | 1.20E-12 | mr1362 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120024869 | NA | 1.10E-09 | mr1565 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120024869 | NA | 7.66E-08 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120024869 | NA | 7.01E-06 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120024869 | NA | 1.12E-12 | mr1147_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120024869 | NA | 4.92E-06 | mr1402_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120024869 | NA | 4.50E-09 | mr1565_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120024869 | NA | 2.40E-09 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120024869 | NA | 5.46E-07 | mr1624_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120024869 | 4.08E-06 | NA | mr1739_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120024869 | NA | 3.59E-09 | mr1739_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120024869 | NA | 1.94E-06 | mr1901_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120024869 | NA | 1.28E-06 | mr1959_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |