\
| Variant ID: vg0120024417 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 20024417 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 236. )
ATAAATAATTAAGGCTTTTTCTTTTATAGTAAAAACACAGAGAATCTTCTAAAATCATAAGTAATTCATCCGAGCTCTGATTAAGTCCATTCAAGTCTCA[G/A]
TAAATTCATAAAAACGTATAGAATCCATTAAAAATGGTTTTGTTTCCTGTTTCAGTAGTCTTATAGCATGTTTTGCTTGTGTGCTTTGTTTGTCGCGTAG
CTACGCGACAAACAAAGCACACAAGCAAAACATGCTATAAGACTACTGAAACAGGAAACAAAACCATTTTTAATGGATTCTATACGTTTTTATGAATTTA[C/T]
TGAGACTTGAATGGACTTAATCAGAGCTCGGATGAATTACTTATGATTTTAGAAGATTCTCTGTGTTTTTACTATAAAAGAAAAAGCCTTAATTATTTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.60% | 6.90% | 0.47% | 0.00% | NA |
| All Indica | 2759 | 87.70% | 11.70% | 0.65% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 56.60% | 40.90% | 2.58% | 0.00% | NA |
| Indica III | 913 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 84.90% | 14.50% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 5.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0120024417 | G -> A | LOC_Os01g36200.1 | upstream_gene_variant ; 977.0bp to feature; MODIFIER | silent_mutation | Average:50.707; most accessible tissue: Minghui63 flag leaf, score: 69.182 | N | N | N | N |
| vg0120024417 | G -> A | LOC_Os01g36200-LOC_Os01g36220 | intergenic_region ; MODIFIER | silent_mutation | Average:50.707; most accessible tissue: Minghui63 flag leaf, score: 69.182 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0120024417 | NA | 2.97E-08 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120024417 | NA | 6.74E-07 | mr1231 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120024417 | 1.76E-06 | 1.76E-06 | mr1362 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120024417 | NA | 1.15E-07 | mr1557 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120024417 | NA | 8.38E-14 | mr1565 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120024417 | NA | 8.08E-12 | mr1565 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120024417 | NA | 3.15E-06 | mr1771 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120024417 | NA | 8.68E-10 | mr1327_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120024417 | NA | 1.15E-07 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120024417 | NA | 4.76E-13 | mr1565_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120024417 | NA | 5.72E-11 | mr1565_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120024417 | NA | 4.57E-11 | mr1598_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |