Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119929664:

Variant ID: vg0119929664 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 19929664
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.62, T: 0.40, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

ATACCTTCAACTTCCTTCAAAGCCAGGTCTCTTTGTCTTGCCAGTTCTGCCTTGTCATTTTCCAGAGTTTGAATTTGCTTCTCCAACTGAGATATCTTGG[T/C]
AGCTTGCACTACATTGATTACTGTAAATCAAGATTGCAAAGATAACAGTATAAGTCAGTTGGGCAGAGTTTGTGCAAACCTTTCGATGAGCCACTCAGTT

Reverse complement sequence

AACTGAGTGGCTCATCGAAAGGTTTGCACAAACTCTGCCCAACTGACTTATACTGTTATCTTTGCAATCTTGATTTACAGTAATCAATGTAGTGCAAGCT[A/G]
CCAAGATATCTCAGTTGGAGAAGCAAATTCAAACTCTGGAAAATGACAAGGCAGAACTGGCAAGACAAAGAGACCTGGCTTTGAAGGAAGTTGAAGGTAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.80%	19.30%	8.76%	0.11%	NA
All Indica	2759	53.30%	32.20%	14.32%	0.18%	NA
All Japonica	1512	99.20%	0.10%	0.66%	0.00%	NA
Aus	269	92.90%	6.30%	0.74%	0.00%	NA
Indica I	595	52.60%	39.50%	7.90%	0.00%	NA
Indica II	465	82.20%	7.30%	10.54%	0.00%	NA
Indica III	913	32.40%	46.30%	21.03%	0.22%	NA
Indica Intermediate	786	60.90%	25.10%	13.61%	0.38%	NA
Temperate Japonica	767	98.40%	0.30%	1.30%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	88.90%	4.40%	6.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0119929664	T -> DEL	LOC_Os01g36020.1	N	frameshift_variant	Average:31.171; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0119929664	T -> C	LOC_Os01g36020.1	missense_variant ; p.Thr504Ala; MODERATE	nonsynonymous_codon ; T504A	Average:31.171; most accessible tissue: Minghui63 panicle, score: 46.754	possibly damaging	-1.757	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0119929664	NA	2.28E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119929664	NA	2.44E-06	mr1042	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119929664	NA	2.15E-07	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119929664	NA	1.55E-06	mr1043	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119929664	NA	7.52E-08	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119929664	NA	4.79E-09	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119929664	NA	1.67E-07	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119929664	NA	6.35E-06	mr1185	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119929664	NA	2.20E-07	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119929664	NA	1.53E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119929664	NA	7.36E-06	mr1734	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119929664	NA	7.12E-07	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119929664	NA	1.07E-06	mr1215_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119929664	NA	2.34E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119929664	NA	4.37E-06	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119929664	NA	6.60E-07	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119929664	NA	4.84E-07	mr1422_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119929664	NA	3.99E-07	mr1510_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119929664	NA	6.42E-07	mr1517_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119929664	NA	5.60E-10	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119929664	NA	5.72E-06	mr1696_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119929664	NA	9.35E-06	mr1721_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119929664	NA	6.82E-06	mr1825_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119929664	NA	4.68E-06	mr1882_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119929664	NA	6.42E-06	mr1954_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119929664	NA	3.25E-08	mr1954_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119929664	NA	7.94E-07	mr1972_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251