Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119926212:

Variant ID: vg0119926212 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 19926212
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.24, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:

GATCGGTCGCAATGTTGAAGCCTATGTTGATGATGTAGTCGTCAAGACCAAGCAGAAGGATGACCTAATTCCGGATTTAGAAGAAACTTTGACAAGCATT[T/C]
GTGCTTTCAAGATGAAACTAAACCCGGAAAAGTGCATCTTCGGAGTACCGTCAGGGAAGTTGCTCGGATTTATGGTATCTCAGAGAGGCATACAGGCCAA

Reverse complement sequence

TTGGCCTGTATGCCTCTCTGAGATACCATAAATCCGAGCAACTTCCCTGACGGTACTCCGAAGATGCACTTTTCCGGGTTTAGTTTCATCTTGAAAGCAC[A/G]
AATGCTTGTCAAAGTTTCTTCTAAATCCGGAATTAGGTCATCCTTCTGCTTGGTCTTGACGACTACATCATCAACATAGGCTTCAACATTGCGACCGATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.60%	26.60%	2.84%	0.00%	NA
All Indica	2759	55.10%	40.70%	4.24%	0.00%	NA
All Japonica	1512	97.80%	1.90%	0.40%	0.00%	NA
Aus	269	61.70%	34.90%	3.35%	0.00%	NA
Indica I	595	56.30%	35.30%	8.40%	0.00%	NA
Indica II	465	82.80%	14.80%	2.37%	0.00%	NA
Indica III	913	36.70%	61.90%	1.42%	0.00%	NA
Indica Intermediate	786	59.00%	35.50%	5.47%	0.00%	NA
Temperate Japonica	767	98.40%	0.80%	0.78%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	94.20%	5.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	11.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0119926212	T -> C	LOC_Os01g36010.1	missense_variant ; p.Cys200Arg; MODERATE	nonsynonymous_codon ; C200R	Average:37.169; most accessible tissue: Minghui63 flag leaf, score: 52.88	benign	0.515	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0119926212	NA	5.40E-06	mr1042	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119926212	NA	1.45E-06	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119926212	NA	3.21E-07	mr1175_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119926212	NA	2.53E-06	mr1331_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119926212	NA	8.90E-09	mr1510_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119926212	NA	7.19E-08	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119926212	8.45E-06	8.45E-06	mr1523_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119926212	1.76E-06	2.49E-08	mr1702_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119926212	NA	1.94E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119926212	NA	3.65E-07	mr1882_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119926212	NA	3.51E-07	mr1882_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251