\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119926212:

Variant ID: vg0119926212 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 19926212
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.24, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


GATCGGTCGCAATGTTGAAGCCTATGTTGATGATGTAGTCGTCAAGACCAAGCAGAAGGATGACCTAATTCCGGATTTAGAAGAAACTTTGACAAGCATT[T/C]
GTGCTTTCAAGATGAAACTAAACCCGGAAAAGTGCATCTTCGGAGTACCGTCAGGGAAGTTGCTCGGATTTATGGTATCTCAGAGAGGCATACAGGCCAA

Reverse complement sequence

TTGGCCTGTATGCCTCTCTGAGATACCATAAATCCGAGCAACTTCCCTGACGGTACTCCGAAGATGCACTTTTCCGGGTTTAGTTTCATCTTGAAAGCAC[A/G]
AATGCTTGTCAAAGTTTCTTCTAAATCCGGAATTAGGTCATCCTTCTGCTTGGTCTTGACGACTACATCATCAACATAGGCTTCAACATTGCGACCGATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.60% 26.60% 2.84% 0.00% NA
All Indica  2759 55.10% 40.70% 4.24% 0.00% NA
All Japonica  1512 97.80% 1.90% 0.40% 0.00% NA
Aus  269 61.70% 34.90% 3.35% 0.00% NA
Indica I  595 56.30% 35.30% 8.40% 0.00% NA
Indica II  465 82.80% 14.80% 2.37% 0.00% NA
Indica III  913 36.70% 61.90% 1.42% 0.00% NA
Indica Intermediate  786 59.00% 35.50% 5.47% 0.00% NA
Temperate Japonica  767 98.40% 0.80% 0.78% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 94.20% 5.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 11.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0119926212 T -> C LOC_Os01g36010.1 missense_variant ; p.Cys200Arg; MODERATE nonsynonymous_codon ; C200R Average:37.169; most accessible tissue: Minghui63 flag leaf, score: 52.88 benign 0.515 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0119926212 NA 5.40E-06 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119926212 NA 1.45E-06 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119926212 NA 3.21E-07 mr1175_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119926212 NA 2.53E-06 mr1331_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119926212 NA 8.90E-09 mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119926212 NA 7.19E-08 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119926212 8.45E-06 8.45E-06 mr1523_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119926212 1.76E-06 2.49E-08 mr1702_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119926212 NA 1.94E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119926212 NA 3.65E-07 mr1882_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119926212 NA 3.51E-07 mr1882_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251