Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119923264:

Variant ID: vg0119923264 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 19923264
Reference Allele: CAG	Alternative Allele: CAAG,TAG,C
Primary Allele: CAG	Secondary Allele: CAAG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGAGGATAACTACACGCCTCTCTTCTTCGGCGTATTCATGGCTGACAACGAAACGGAAGAACAGCGCCGAGCCCGAGAAGCGGACCAAGATCGCGTACGA[CAG/CAAG,TAG,C]
AAGCTGAACGTCGCCGACTAGAGGAAGAGCGACAGCGACAGGAGCGAGAACGACTACAGCGTGAGCAACAAGATCGCGAACGGGTTGCAAAGGAGGCTGA

Reverse complement sequence

TCAGCCTCCTTTGCAACCCGTTCGCGATCTTGTTGCTCACGCTGTAGTCGTTCTCGCTCCTGTCGCTGTCGCTCTTCCTCTAGTCGGCGACGTTCAGCTT[CTG/CTTG,CTA,G]
TCGTACGCGATCTTGGTCCGCTTCTCGGGCTCGGCGCTGTTCTTCCGTTTCGTTGTCAGCCATGAATACGCCGAAGAAGAGAGGCGTGTAGTTATCCTCA

Allele Frequencies:

Populations	Population Size	Frequency of CAG(primary allele)	Frequency of CAAG(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.10%	25.10%	3.30%	1.10%	TAG: 10.11%; C: 0.30%
All Indica	2759	34.80%	41.80%	4.71%	1.88%	TAG: 16.35%; C: 0.47%
All Japonica	1512	97.30%	0.70%	0.66%	0.00%	TAG: 1.32%; C: 0.07%
Aus	269	91.10%	5.90%	2.97%	0.00%	NA
Indica I	595	45.00%	45.40%	4.37%	1.34%	TAG: 3.70%; C: 0.17%
Indica II	465	38.90%	10.50%	9.25%	0.43%	TAG: 40.65%; C: 0.22%
Indica III	913	23.20%	61.70%	2.30%	2.63%	TAG: 9.31%; C: 0.88%
Indica Intermediate	786	38.20%	34.40%	5.09%	2.29%	TAG: 19.72%; C: 0.38%
Temperate Japonica	767	98.00%	1.30%	0.52%	0.00%	C: 0.13%
Tropical Japonica	504	95.40%	0.00%	0.79%	0.00%	TAG: 3.77%
Japonica Intermediate	241	98.80%	0.00%	0.83%	0.00%	TAG: 0.41%
VI/Aromatic	96	97.90%	1.00%	0.00%	0.00%	TAG: 1.04%
Intermediate	90	74.40%	10.00%	8.89%	0.00%	TAG: 6.67%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0119923264	CAG -> CAAG	LOC_Os01g36010.1	upstream_gene_variant ; 2349.0bp to feature; MODIFIER	silent_mutation	Average:64.339; most accessible tissue: Zhenshan97 flag leaf, score: 76.925	N	N	N	N
vg0119923264	CAG -> CAAG	LOC_Os01g36000.1	intron_variant ; MODIFIER	silent_mutation	Average:64.339; most accessible tissue: Zhenshan97 flag leaf, score: 76.925	N	N	N	N
vg0119923264	CAG -> DEL	N	N	silent_mutation	Average:64.339; most accessible tissue: Zhenshan97 flag leaf, score: 76.925	N	N	N	N
vg0119923264	CAG -> C	LOC_Os01g36000.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:64.339; most accessible tissue: Zhenshan97 flag leaf, score: 76.925	N	N	N	N
vg0119923264	CAG -> C	LOC_Os01g36010.1	upstream_gene_variant ; 2350.0bp to feature; MODIFIER	silent_mutation	Average:64.339; most accessible tissue: Zhenshan97 flag leaf, score: 76.925	N	N	N	N
vg0119923264	CAG -> TAG	LOC_Os01g36000.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:64.339; most accessible tissue: Zhenshan97 flag leaf, score: 76.925	N	N	N	N
vg0119923264	CAG -> TAG	LOC_Os01g36010.1	upstream_gene_variant ; 2351.0bp to feature; MODIFIER	silent_mutation	Average:64.339; most accessible tissue: Zhenshan97 flag leaf, score: 76.925	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0119923264	NA	2.97E-06	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119923264	NA	9.98E-07	mr1550	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119923264	NA	2.90E-11	mr1565	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119923264	NA	5.15E-09	mr1565	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119923264	6.83E-07	6.83E-07	mr1762	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119923264	NA	6.98E-08	mr1320_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119923264	NA	2.25E-06	mr1320_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119923264	NA	2.50E-06	mr1388_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119923264	NA	3.58E-06	mr1402_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119923264	NA	1.32E-08	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119923264	NA	4.88E-07	mr1428_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119923264	NA	1.90E-06	mr1438_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119923264	NA	6.20E-07	mr1482_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119923264	NA	4.15E-07	mr1510_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119923264	NA	2.82E-07	mr1550_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119923264	NA	2.24E-06	mr1762_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251