\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119921823:

Variant ID: vg0119921823 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 19921823
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, C: 0.19, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:


AACCTCACCCTTCTAATTATTTAAAATTAGATCATTCTCTAATATTTGCATATTTTTATATCTATTTCTATATATGTCTTCTCCGATCAATCAAATTGAA[C/G]
AGAAAAGTTTAGGGAAAATTGAAGAGAAACAAAAGTGAAGGTGAAGAAAATGTAAAAACTAATGGAGAAAACTTCCACCAATAAGCTAGAGGTGAACTGC

Reverse complement sequence

GCAGTTCACCTCTAGCTTATTGGTGGAAGTTTTCTCCATTAGTTTTTACATTTTCTTCACCTTCACTTTTGTTTCTCTTCAATTTTCCCTAAACTTTTCT[G/C]
TTCAATTTGATTGATCGGAGAAGACATATATAGAAATAGATATAAAAATATGCAAATATTAGAGAATGATCTAATTTTAAATAATTAGAAGGGTGAGGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 32.10% 0.06% 0.00% NA
All Indica  2759 50.50% 49.40% 0.07% 0.00% NA
All Japonica  1512 97.80% 2.20% 0.00% 0.00% NA
Aus  269 61.00% 39.00% 0.00% 0.00% NA
Indica I  595 50.80% 49.10% 0.17% 0.00% NA
Indica II  465 81.50% 18.50% 0.00% 0.00% NA
Indica III  913 30.90% 69.00% 0.11% 0.00% NA
Indica Intermediate  786 54.70% 45.30% 0.00% 0.00% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 94.20% 5.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 83.30% 15.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0119921823 C -> G LOC_Os01g36000.1 upstream_gene_variant ; 814.0bp to feature; MODIFIER silent_mutation Average:47.045; most accessible tissue: Minghui63 panicle, score: 86.442 N N N N
vg0119921823 C -> G LOC_Os01g36010.1 upstream_gene_variant ; 3792.0bp to feature; MODIFIER silent_mutation Average:47.045; most accessible tissue: Minghui63 panicle, score: 86.442 N N N N
vg0119921823 C -> G LOC_Os01g35990-LOC_Os01g36000 intergenic_region ; MODIFIER silent_mutation Average:47.045; most accessible tissue: Minghui63 panicle, score: 86.442 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0119921823 NA 1.22E-07 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823 NA 2.96E-07 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823 NA 2.30E-07 mr1043 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823 NA 2.34E-07 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823 NA 3.02E-18 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823 NA 3.58E-08 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823 NA 7.80E-07 mr1185 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823 NA 1.02E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823 NA 6.46E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823 NA 1.53E-06 mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823 NA 7.34E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823 3.44E-06 NA mr1519_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823 NA 3.98E-10 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823 NA 9.85E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823 NA 8.13E-07 mr1882_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823 NA 7.33E-06 mr1882_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823 NA 2.84E-06 mr1954_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823 NA 5.73E-06 mr1972_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251