Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119921823:

Variant ID: vg0119921823 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 19921823
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, C: 0.19, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:

AACCTCACCCTTCTAATTATTTAAAATTAGATCATTCTCTAATATTTGCATATTTTTATATCTATTTCTATATATGTCTTCTCCGATCAATCAAATTGAA[C/G]
AGAAAAGTTTAGGGAAAATTGAAGAGAAACAAAAGTGAAGGTGAAGAAAATGTAAAAACTAATGGAGAAAACTTCCACCAATAAGCTAGAGGTGAACTGC

Reverse complement sequence

GCAGTTCACCTCTAGCTTATTGGTGGAAGTTTTCTCCATTAGTTTTTACATTTTCTTCACCTTCACTTTTGTTTCTCTTCAATTTTCCCTAAACTTTTCT[G/C]
TTCAATTTGATTGATCGGAGAAGACATATATAGAAATAGATATAAAAATATGCAAATATTAGAGAATGATCTAATTTTAAATAATTAGAAGGGTGAGGTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.80%	32.10%	0.06%	0.00%	NA
All Indica	2759	50.50%	49.40%	0.07%	0.00%	NA
All Japonica	1512	97.80%	2.20%	0.00%	0.00%	NA
Aus	269	61.00%	39.00%	0.00%	0.00%	NA
Indica I	595	50.80%	49.10%	0.17%	0.00%	NA
Indica II	465	81.50%	18.50%	0.00%	0.00%	NA
Indica III	913	30.90%	69.00%	0.11%	0.00%	NA
Indica Intermediate	786	54.70%	45.30%	0.00%	0.00%	NA
Temperate Japonica	767	98.40%	1.60%	0.00%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	94.20%	5.80%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	83.30%	15.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0119921823	C -> G	LOC_Os01g36000.1	upstream_gene_variant ; 814.0bp to feature; MODIFIER	silent_mutation	Average:47.045; most accessible tissue: Minghui63 panicle, score: 86.442	N	N	N	N
vg0119921823	C -> G	LOC_Os01g36010.1	upstream_gene_variant ; 3792.0bp to feature; MODIFIER	silent_mutation	Average:47.045; most accessible tissue: Minghui63 panicle, score: 86.442	N	N	N	N
vg0119921823	C -> G	LOC_Os01g35990-LOC_Os01g36000	intergenic_region ; MODIFIER	silent_mutation	Average:47.045; most accessible tissue: Minghui63 panicle, score: 86.442	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0119921823	NA	1.22E-07	mr1042	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823	NA	2.96E-07	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823	NA	2.30E-07	mr1043	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823	NA	2.34E-07	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823	NA	3.02E-18	mr1133	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823	NA	3.58E-08	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823	NA	7.80E-07	mr1185	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823	NA	1.02E-06	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823	NA	6.46E-06	mr1422_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823	NA	1.53E-06	mr1510_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823	NA	7.34E-07	mr1517_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823	3.44E-06	NA	mr1519_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823	NA	3.98E-10	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823	NA	9.85E-08	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823	NA	8.13E-07	mr1882_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823	NA	7.33E-06	mr1882_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823	NA	2.84E-06	mr1954_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119921823	NA	5.73E-06	mr1972_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251