\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119910417:

Variant ID: vg0119910417 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 19910417
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.60, C: 0.40, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


AAACACTTAACCTTCATCAGAAGAAAAAAAACACTAAAATTGGTTTAAAAAAATCAAATCTCTCTGCACCGCCGCCCCCCACCCCGCCACACACACACAC[A/C]
ATGCCGTGGAACTAAACACCGCAATAGACGTCATCACGTGGGATTGGGGGCAACCCGGTAGCCCGAACCGCGTATCGTCGCCGCCATGACGCCATCGATC

Reverse complement sequence

GATCGATGGCGTCATGGCGGCGACGATACGCGGTTCGGGCTACCGGGTTGCCCCCAATCCCACGTGATGACGTCTATTGCGGTGTTTAGTTCCACGGCAT[T/G]
GTGTGTGTGTGTGGCGGGGTGGGGGGCGGCGGTGCAGAGAGATTTGATTTTTTTAAACCAATTTTAGTGTTTTTTTTCTTCTGATGAAGGTTAAGTGTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.50% 1.20% 8.15% 5.14% NA
All Indica  2759 79.00% 2.00% 10.51% 8.52% NA
All Japonica  1512 98.30% 0.00% 1.59% 0.13% NA
Aus  269 73.60% 0.40% 24.91% 1.12% NA
Indica I  595 73.30% 0.30% 16.97% 9.41% NA
Indica II  465 71.40% 0.20% 12.47% 15.91% NA
Indica III  913 90.50% 5.00% 2.08% 2.41% NA
Indica Intermediate  786 74.60% 0.60% 14.25% 10.56% NA
Temperate Japonica  767 98.70% 0.00% 1.30% 0.00% NA
Tropical Japonica  504 99.00% 0.00% 0.79% 0.20% NA
Japonica Intermediate  241 95.40% 0.00% 4.15% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 0.00% 4.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0119910417 A -> DEL N N silent_mutation Average:86.417; most accessible tissue: Minghui63 root, score: 99.221 N N N N
vg0119910417 A -> C LOC_Os01g35980.1 upstream_gene_variant ; 1016.0bp to feature; MODIFIER silent_mutation Average:86.417; most accessible tissue: Minghui63 root, score: 99.221 N N N N
vg0119910417 A -> C LOC_Os01g35970.1 downstream_gene_variant ; 4020.0bp to feature; MODIFIER silent_mutation Average:86.417; most accessible tissue: Minghui63 root, score: 99.221 N N N N
vg0119910417 A -> C LOC_Os01g35990.1 downstream_gene_variant ; 806.0bp to feature; MODIFIER silent_mutation Average:86.417; most accessible tissue: Minghui63 root, score: 99.221 N N N N
vg0119910417 A -> C LOC_Os01g35980-LOC_Os01g35990 intergenic_region ; MODIFIER silent_mutation Average:86.417; most accessible tissue: Minghui63 root, score: 99.221 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0119910417 A C 0.02 0.03 0.04 0.0 -0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0119910417 NA 2.69E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119910417 NA 3.90E-11 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119910417 NA 8.75E-07 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119910417 NA 9.64E-06 mr1175_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119910417 NA 1.66E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119910417 NA 1.93E-07 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119910417 NA 7.02E-06 mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119910417 NA 4.12E-06 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119910417 NA 3.71E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119910417 NA 1.40E-09 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119910417 NA 5.61E-08 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119910417 NA 3.26E-10 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119910417 NA 6.87E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119910417 NA 1.55E-11 mr1654_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119910417 NA 1.12E-09 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119910417 NA 4.93E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251