\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119895987:

Variant ID: vg0119895987 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 19895987
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


TATGTATGCATTAGTAGCATGCGTATTTGTAATTCTGGTGTTGTATGTTAAGCTGTGATCTTCCTGTATATGCAGTGTACTAGCATGTAATCAGTACTGA[T/A]
ATATGTCATGGAGGCTATCTGAACCAGCATGTTTCTCAATTTGTGATGGTCATGTTTTGTGCAATAAAGTGTGTGTGCAGTTAGTATAAATCAATCACAA

Reverse complement sequence

TTGTGATTGATTTATACTAACTGCACACACACTTTATTGCACAAAACATGACCATCACAAATTGAGAAACATGCTGGTTCAGATAGCCTCCATGACATAT[A/T]
TCAGTACTGATTACATGCTAGTACACTGCATATACAGGAAGATCACAGCTTAACATACAACACCAGAATTACAAATACGCATGCTACTAATGCATACATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.80% 0.10% 13.10% 14.98% NA
All Indica  2759 55.50% 0.20% 20.70% 23.63% NA
All Japonica  1512 98.30% 0.00% 0.99% 0.73% NA
Aus  269 76.20% 0.00% 10.04% 13.75% NA
Indica I  595 51.60% 0.30% 30.76% 17.31% NA
Indica II  465 68.40% 0.00% 6.24% 25.38% NA
Indica III  913 46.10% 0.10% 22.12% 31.65% NA
Indica Intermediate  786 61.70% 0.30% 19.97% 18.07% NA
Temperate Japonica  767 99.10% 0.00% 0.00% 0.91% NA
Tropical Japonica  504 98.60% 0.00% 0.79% 0.60% NA
Japonica Intermediate  241 95.00% 0.00% 4.56% 0.41% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 85.60% 0.00% 6.67% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0119895987 T -> A LOC_Os01g35950.1 downstream_gene_variant ; 1240.0bp to feature; MODIFIER silent_mutation Average:45.501; most accessible tissue: Minghui63 flag leaf, score: 70.648 N N N N
vg0119895987 T -> A LOC_Os01g35960.1 downstream_gene_variant ; 318.0bp to feature; MODIFIER silent_mutation Average:45.501; most accessible tissue: Minghui63 flag leaf, score: 70.648 N N N N
vg0119895987 T -> A LOC_Os01g35950-LOC_Os01g35960 intergenic_region ; MODIFIER silent_mutation Average:45.501; most accessible tissue: Minghui63 flag leaf, score: 70.648 N N N N
vg0119895987 T -> DEL N N silent_mutation Average:45.501; most accessible tissue: Minghui63 flag leaf, score: 70.648 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0119895987 7.98E-06 NA mr1471 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987 NA 4.70E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987 7.30E-08 NA mr1645 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987 1.17E-06 5.59E-06 mr1645 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987 5.18E-07 NA mr1647 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987 2.67E-06 5.15E-06 mr1647 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987 NA 4.51E-06 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987 NA 9.25E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987 NA 1.18E-07 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987 NA 1.76E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987 NA 8.25E-06 mr1302_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987 NA 1.71E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987 NA 3.58E-06 mr1528_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987 NA 1.07E-06 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987 NA 6.41E-06 mr1735_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987 NA 8.75E-06 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987 NA 5.98E-06 mr1854_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987 NA 8.18E-06 mr1854_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251