Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119895987:

Variant ID: vg0119895987 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 19895987
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

TATGTATGCATTAGTAGCATGCGTATTTGTAATTCTGGTGTTGTATGTTAAGCTGTGATCTTCCTGTATATGCAGTGTACTAGCATGTAATCAGTACTGA[T/A]
ATATGTCATGGAGGCTATCTGAACCAGCATGTTTCTCAATTTGTGATGGTCATGTTTTGTGCAATAAAGTGTGTGTGCAGTTAGTATAAATCAATCACAA

Reverse complement sequence

TTGTGATTGATTTATACTAACTGCACACACACTTTATTGCACAAAACATGACCATCACAAATTGAGAAACATGCTGGTTCAGATAGCCTCCATGACATAT[A/T]
TCAGTACTGATTACATGCTAGTACACTGCATATACAGGAAGATCACAGCTTAACATACAACACCAGAATTACAAATACGCATGCTACTAATGCATACATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.80%	0.10%	13.10%	14.98%	NA
All Indica	2759	55.50%	0.20%	20.70%	23.63%	NA
All Japonica	1512	98.30%	0.00%	0.99%	0.73%	NA
Aus	269	76.20%	0.00%	10.04%	13.75%	NA
Indica I	595	51.60%	0.30%	30.76%	17.31%	NA
Indica II	465	68.40%	0.00%	6.24%	25.38%	NA
Indica III	913	46.10%	0.10%	22.12%	31.65%	NA
Indica Intermediate	786	61.70%	0.30%	19.97%	18.07%	NA
Temperate Japonica	767	99.10%	0.00%	0.00%	0.91%	NA
Tropical Japonica	504	98.60%	0.00%	0.79%	0.60%	NA
Japonica Intermediate	241	95.00%	0.00%	4.56%	0.41%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	85.60%	0.00%	6.67%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0119895987	T -> A	LOC_Os01g35950.1	downstream_gene_variant ; 1240.0bp to feature; MODIFIER	silent_mutation	Average:45.501; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0119895987	T -> A	LOC_Os01g35960.1	downstream_gene_variant ; 318.0bp to feature; MODIFIER	silent_mutation	Average:45.501; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0119895987	T -> A	LOC_Os01g35950-LOC_Os01g35960	intergenic_region ; MODIFIER	silent_mutation	Average:45.501; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0119895987	T -> DEL	N	N	silent_mutation	Average:45.501; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0119895987	7.98E-06	NA	mr1471	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987	NA	4.70E-06	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987	7.30E-08	NA	mr1645	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987	1.17E-06	5.59E-06	mr1645	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987	5.18E-07	NA	mr1647	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987	2.67E-06	5.15E-06	mr1647	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987	NA	4.51E-06	mr1660	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987	NA	9.25E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987	NA	1.18E-07	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987	NA	1.76E-06	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987	NA	8.25E-06	mr1302_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987	NA	1.71E-06	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987	NA	3.58E-06	mr1528_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987	NA	1.07E-06	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987	NA	6.41E-06	mr1735_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987	NA	8.75E-06	mr1735_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987	NA	5.98E-06	mr1854_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119895987	NA	8.18E-06	mr1854_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251