\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119838948:

Variant ID: vg0119838948 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 19838948
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTAAAGATCCACTCCGCATATCGACAAGGCCGAATAAACCCAGCTTTCAATAACCGATCAATTTCTTCTTTGATACGGTCATACATATCAGAATTAAAA[A/C]
GTCTAGGGGGTTGTTTATACGGCCGAAAACCAGATTTAATAGGCAACCTATGCTCAACTAAATCCCTACTCAAACCAGGCATCTCAGTATAACTCCAAGC

Reverse complement sequence

GCTTGGAGTTATACTGAGATGCCTGGTTTGAGTAGGGATTTAGTTGAGCATAGGTTGCCTATTAAATCTGGTTTTCGGCCGTATAAACAACCCCCTAGAC[T/G]
TTTTAATTCTGATATGTATGACCGTATCAAAGAAGAAATTGATCGGTTATTGAAAGCTGGGTTTATTCGGCCTTGTCGATATGCGGAGTGGATCTTTAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.70% 1.20% 15.00% 14.01% NA
All Indica  2759 52.00% 1.90% 23.74% 22.33% NA
All Japonica  1512 98.20% 0.00% 0.79% 0.99% NA
Aus  269 75.50% 1.90% 13.75% 8.92% NA
Indica I  595 59.20% 2.00% 20.34% 18.49% NA
Indica II  465 71.20% 1.70% 5.81% 21.29% NA
Indica III  913 33.60% 1.80% 38.99% 25.63% NA
Indica Intermediate  786 56.60% 2.20% 19.21% 22.01% NA
Temperate Japonica  767 98.70% 0.00% 1.17% 0.13% NA
Tropical Japonica  504 98.60% 0.00% 0.20% 1.19% NA
Japonica Intermediate  241 95.90% 0.00% 0.83% 3.32% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 86.70% 1.10% 4.44% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0119838948 A -> DEL LOC_Os01g35820.1 N frameshift_variant Average:24.786; most accessible tissue: Minghui63 flag leaf, score: 49.097 N N N N
vg0119838948 A -> C LOC_Os01g35820.1 missense_variant ; p.Leu835Arg; MODERATE nonsynonymous_codon ; L835R Average:24.786; most accessible tissue: Minghui63 flag leaf, score: 49.097 benign -0.12 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0119838948 NA 5.53E-06 mr1817 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 1.11E-06 mr1041_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 5.74E-08 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 5.15E-07 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 1.81E-07 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 9.36E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 9.81E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 2.79E-08 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 1.12E-07 mr1137_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 3.26E-06 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 1.33E-08 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 1.78E-06 1.78E-06 mr1153_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 3.21E-06 mr1159_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 1.37E-07 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 1.86E-09 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 8.22E-06 mr1288_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 5.76E-06 mr1294_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 1.60E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 2.26E-06 mr1299_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 4.28E-06 mr1345_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 6.45E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 3.60E-06 mr1402_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 5.58E-06 mr1407_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 3.87E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 3.57E-09 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 9.62E-06 mr1447_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 2.70E-07 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 3.82E-06 3.82E-06 mr1523_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 6.58E-07 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 1.03E-09 mr1557_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 9.07E-06 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 2.30E-06 mr1562_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 4.86E-09 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 2.72E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 5.19E-06 mr1604_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 9.96E-07 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 1.41E-06 mr1617_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 1.68E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 4.08E-07 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 7.52E-06 mr1646_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 1.56E-06 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 7.68E-06 mr1661_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 4.35E-09 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 7.74E-07 mr1700_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 3.10E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 2.93E-06 2.93E-06 mr1727_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 6.54E-07 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 4.30E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 2.70E-06 mr1763_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 5.77E-07 mr1771_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 1.32E-06 mr1814_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 2.59E-06 mr1823_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 5.43E-06 mr1824_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 9.85E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 1.37E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 8.63E-06 mr1831_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 9.12E-07 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 7.33E-06 mr1854_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 1.64E-06 mr1854_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 7.17E-06 mr1856_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 7.68E-06 mr1876_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 4.80E-06 mr1894_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 1.45E-06 mr1901_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 4.14E-06 mr1901_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 1.43E-06 mr1921_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119838948 NA 5.74E-06 mr1976_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251