Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119837345:

Variant ID: vg0119837345 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 19837345
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


TTACAAAAAACACTCCCCTGTTAACATGATAGCCAGACCCCTGTTGTGCTAAGAAATTTGCTCTAACATTATCCTCTCTAGATATGTGACGAATAGTAAA[C/A]
GTGTCAAGCGATTTAATTATATCCAAACATCGGTCCAAATAACTATTCAGTAGTCCATCAAAACAATTGAATTCACCATTAACTTGCTCAACTACTAAAC

Reverse complement sequence

GTTTAGTAGTTGAGCAAGTTAATGGTGAATTCAATTGTTTTGATGGACTACTGAATAGTTATTTGGACCGATGTTTGGATATAATTAAATCGCTTGACAC[G/T]
TTTACTATTCGTCACATATCTAGAGAGGATAATGTTAGAGCAAATTTCTTAGCACAACAGGGGTCTGGCTATCATGTTAACAGGGGAGTGTTTTTTGTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.50% 25.70% 3.87% 0.93% NA
All Indica  2759 51.70% 41.00% 5.91% 1.41% NA
All Japonica  1512 98.30% 1.20% 0.26% 0.26% NA
Aus  269 73.60% 21.60% 4.46% 0.37% NA
Indica I  595 58.80% 36.00% 3.70% 1.51% NA
Indica II  465 71.80% 16.30% 8.17% 3.66% NA
Indica III  913 33.60% 59.70% 6.13% 0.55% NA
Indica Intermediate  786 55.50% 37.50% 5.98% 1.02% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 0.80% 0.40% 0.00% NA
Japonica Intermediate  241 95.90% 1.70% 0.83% 1.66% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 10.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0119837345 C -> A LOC_Os01g35820.1 synonymous_variant ; p.Thr1270Thr; LOW synonymous_codon Average:22.48; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N
vg0119837345 C -> DEL LOC_Os01g35820.1 N frameshift_variant Average:22.48; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0119837345 NA 1.54E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119837345 NA 9.83E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119837345 NA 5.16E-08 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119837345 NA 2.10E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119837345 NA 6.23E-06 mr1159_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119837345 NA 9.80E-09 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119837345 NA 5.57E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119837345 NA 3.75E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119837345 NA 4.72E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119837345 NA 3.53E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119837345 NA 9.01E-07 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119837345 2.36E-06 2.36E-06 mr1523_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119837345 NA 2.45E-07 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119837345 NA 6.86E-09 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119837345 NA 1.02E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119837345 NA 1.32E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119837345 NA 2.53E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119837345 NA 8.74E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119837345 NA 4.82E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119837345 NA 7.86E-06 mr1763_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119837345 NA 6.91E-06 mr1771_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119837345 NA 2.89E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251