\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119711427:

Variant ID: vg0119711427 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 19711427
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


GTGATGTTGATATGTTAGAATTTTAGTTTACCTTACACATGTCATAAGCTCCTTAACTATTTATGCATAAGTTTACTCTAATATTAAATTAAGAGAATGC[T/C]
TATAAAGGTAACTAAGGTGGAATATACCCTATATGAGTTAATTTATTTGTTCACTTCCATGTTCATGACTAGTCTTCAGATGGATGACCAAATAGTTTTG

Reverse complement sequence

CAAAACTATTTGGTCATCCATCTGAAGACTAGTCATGAACATGGAAGTGAACAAATAAATTAACTCATATAGGGTATATTCCACCTTAGTTACCTTTATA[A/G]
GCATTCTCTTAATTTAATATTAGAGTAAACTTATGCATAAATAGTTAAGGAGCTTATGACATGTGTAAGGTAAACTAAAATTCTAACATATCAACATCAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.50% 6.30% 22.51% 3.60% NA
All Indica  2759 46.10% 10.50% 37.26% 6.09% NA
All Japonica  1512 99.50% 0.10% 0.40% 0.00% NA
Aus  269 89.20% 2.20% 8.55% 0.00% NA
Indica I  595 42.20% 12.80% 38.82% 6.22% NA
Indica II  465 73.30% 4.50% 20.86% 1.29% NA
Indica III  913 30.80% 13.30% 48.08% 7.89% NA
Indica Intermediate  786 50.80% 9.30% 33.21% 6.74% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 99.40% 0.00% 0.60% 0.00% NA
Japonica Intermediate  241 99.20% 0.00% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 2.20% 7.78% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0119711427 T -> DEL N N silent_mutation Average:28.707; most accessible tissue: Minghui63 flag leaf, score: 57.881 N N N N
vg0119711427 T -> C LOC_Os01g35610.1 downstream_gene_variant ; 985.0bp to feature; MODIFIER silent_mutation Average:28.707; most accessible tissue: Minghui63 flag leaf, score: 57.881 N N N N
vg0119711427 T -> C LOC_Os01g35620.1 downstream_gene_variant ; 4042.0bp to feature; MODIFIER silent_mutation Average:28.707; most accessible tissue: Minghui63 flag leaf, score: 57.881 N N N N
vg0119711427 T -> C LOC_Os01g35610-LOC_Os01g35620 intergenic_region ; MODIFIER silent_mutation Average:28.707; most accessible tissue: Minghui63 flag leaf, score: 57.881 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0119711427 NA 1.51E-08 mr1072_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427 NA 7.29E-08 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427 NA 3.46E-09 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427 NA 2.43E-10 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427 5.04E-06 5.04E-06 mr1153_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427 NA 7.02E-07 mr1175_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427 NA 5.93E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427 NA 1.69E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427 NA 8.24E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427 NA 8.40E-07 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427 NA 1.58E-06 mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427 NA 2.23E-06 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427 NA 6.65E-08 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427 NA 4.94E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427 NA 7.77E-06 mr1762_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427 NA 3.81E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251