Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119711427:

Variant ID: vg0119711427 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 19711427
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

GTGATGTTGATATGTTAGAATTTTAGTTTACCTTACACATGTCATAAGCTCCTTAACTATTTATGCATAAGTTTACTCTAATATTAAATTAAGAGAATGC[T/C]
TATAAAGGTAACTAAGGTGGAATATACCCTATATGAGTTAATTTATTTGTTCACTTCCATGTTCATGACTAGTCTTCAGATGGATGACCAAATAGTTTTG

Reverse complement sequence

CAAAACTATTTGGTCATCCATCTGAAGACTAGTCATGAACATGGAAGTGAACAAATAAATTAACTCATATAGGGTATATTCCACCTTAGTTACCTTTATA[A/G]
GCATTCTCTTAATTTAATATTAGAGTAAACTTATGCATAAATAGTTAAGGAGCTTATGACATGTGTAAGGTAAACTAAAATTCTAACATATCAACATCAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.50%	6.30%	22.51%	3.60%	NA
All Indica	2759	46.10%	10.50%	37.26%	6.09%	NA
All Japonica	1512	99.50%	0.10%	0.40%	0.00%	NA
Aus	269	89.20%	2.20%	8.55%	0.00%	NA
Indica I	595	42.20%	12.80%	38.82%	6.22%	NA
Indica II	465	73.30%	4.50%	20.86%	1.29%	NA
Indica III	913	30.80%	13.30%	48.08%	7.89%	NA
Indica Intermediate	786	50.80%	9.30%	33.21%	6.74%	NA
Temperate Japonica	767	99.70%	0.10%	0.13%	0.00%	NA
Tropical Japonica	504	99.40%	0.00%	0.60%	0.00%	NA
Japonica Intermediate	241	99.20%	0.00%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	87.80%	2.20%	7.78%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0119711427	T -> DEL	N	N	silent_mutation	Average:28.707; most accessible tissue: Minghui63 flag leaf, score: 57.881	N	N	N	N
vg0119711427	T -> C	LOC_Os01g35610.1	downstream_gene_variant ; 985.0bp to feature; MODIFIER	silent_mutation	Average:28.707; most accessible tissue: Minghui63 flag leaf, score: 57.881	N	N	N	N
vg0119711427	T -> C	LOC_Os01g35620.1	downstream_gene_variant ; 4042.0bp to feature; MODIFIER	silent_mutation	Average:28.707; most accessible tissue: Minghui63 flag leaf, score: 57.881	N	N	N	N
vg0119711427	T -> C	LOC_Os01g35610-LOC_Os01g35620	intergenic_region ; MODIFIER	silent_mutation	Average:28.707; most accessible tissue: Minghui63 flag leaf, score: 57.881	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0119711427	NA	1.51E-08	mr1072_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427	NA	7.29E-08	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427	NA	3.46E-09	mr1077_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427	NA	2.43E-10	mr1141_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427	5.04E-06	5.04E-06	mr1153_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427	NA	7.02E-07	mr1175_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427	NA	5.93E-08	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427	NA	1.69E-07	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427	NA	8.24E-06	mr1428_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427	NA	8.40E-07	mr1482_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427	NA	1.58E-06	mr1510_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427	NA	2.23E-06	mr1539_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427	NA	6.65E-08	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427	NA	4.94E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427	NA	7.77E-06	mr1762_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119711427	NA	3.81E-06	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251