Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119708213:

Variant ID: vg0119708213 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 19708213
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTCTATTTTATCTCATTTCATTTGAGAATTATGAATTTTAGAAGTTTCGTCGGTATAGTGTAGGATTTACTTAGGTACTATTGTGAAATGCTGTTGTAA[C/G]
GTGATTCTTATTAAGTTTATGTTTGCTGGGGTGAATATATGTGTTTTCTAAGACTAACACATTTGGTTTCATAATTTTTAGAGTTAATATGAATTCTTTA

Reverse complement sequence

TAAAGAATTCATATTAACTCTAAAAATTATGAAACCAAATGTGTTAGTCTTAGAAAACACATATATTCACCCCAGCAAACATAAACTTAATAAGAATCAC[G/C]
TTACAACAGCATTTCACAATAGTACCTAAGTAAATCCTACACTATACCGACGAAACTTCTAAAATTCATAATTCTCAAATGAAATGAGATAAAATAGAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.30%	0.70%	9.88%	22.13%	NA
All Indica	2759	46.70%	0.90%	15.77%	36.68%	NA
All Japonica	1512	99.30%	0.00%	0.20%	0.53%	NA
Aus	269	81.00%	3.30%	8.92%	6.69%	NA
Indica I	595	43.50%	0.00%	13.28%	43.19%	NA
Indica II	465	73.50%	0.00%	8.82%	17.63%	NA
Indica III	913	29.50%	2.10%	23.77%	44.69%	NA
Indica Intermediate	786	53.20%	0.60%	12.47%	33.72%	NA
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	99.40%	0.00%	0.00%	0.60%	NA
Japonica Intermediate	241	97.50%	0.00%	1.24%	1.24%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	86.70%	0.00%	4.44%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0119708213	C -> G	LOC_Os01g35600.1	upstream_gene_variant ; 3152.0bp to feature; MODIFIER	silent_mutation	Average:29.186; most accessible tissue: Minghui63 young leaf, score: 54.11	N	N	N	N
vg0119708213	C -> G	LOC_Os01g35610.1	upstream_gene_variant ; 1855.0bp to feature; MODIFIER	silent_mutation	Average:29.186; most accessible tissue: Minghui63 young leaf, score: 54.11	N	N	N	N
vg0119708213	C -> G	LOC_Os01g35600-LOC_Os01g35610	intergenic_region ; MODIFIER	silent_mutation	Average:29.186; most accessible tissue: Minghui63 young leaf, score: 54.11	N	N	N	N
vg0119708213	C -> DEL	N	N	silent_mutation	Average:29.186; most accessible tissue: Minghui63 young leaf, score: 54.11	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0119708213	NA	6.35E-07	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119708213	NA	3.62E-09	mr1565	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119708213	NA	9.81E-17	mr1995	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119708213	NA	4.68E-08	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119708213	NA	1.29E-07	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119708213	NA	1.53E-08	mr1077_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119708213	NA	4.73E-10	mr1141_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119708213	NA	9.65E-06	mr1175_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119708213	NA	4.06E-07	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119708213	NA	8.04E-08	mr1399_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119708213	NA	1.08E-07	mr1428_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119708213	NA	2.73E-06	mr1482_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119708213	NA	1.69E-07	mr1510_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119708213	NA	2.60E-06	mr1539_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119708213	NA	1.26E-07	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119708213	NA	6.28E-06	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119708213	NA	3.28E-09	mr1654_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119708213	5.96E-07	1.51E-10	mr1739_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119708213	NA	4.53E-06	mr1762_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251