\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119703755:

Variant ID: vg0119703755 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 19703755
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.82, A: 0.18, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


GGGTTCGGCTGAACCCCTGGTGGGCCCAACCGGTCCCACTTTCGACCGTTGGATTCCAACAGTCAGTGTGGTCGTGGCACAACAAATTTTTATTAAAAAA[T/A]
TTATTTTATTTTGCTCAGAAAAATTCATTTGAAAGAATTACCTCAAAATTGAAACCTAAATGCAAATTTTGAAAATTCAAACATGGTTTGATGCAAAAAT

Reverse complement sequence

ATTTTTGCATCAAACCATGTTTGAATTTTCAAAATTTGCATTTAGGTTTCAATTTTGAGGTAATTCTTTCAAATGAATTTTTCTGAGCAAAATAAAATAA[A/T]
TTTTTTAATAAAAATTTGTTGTGCCACGACCACACTGACTGTTGGAATCCAACGGTCGAAAGTGGGACCGGTTGGGCCCACCAGGGGTTCAGCCGAACCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.30% 9.60% 7.83% 31.29% NA
All Indica  2759 20.80% 16.00% 11.92% 51.29% NA
All Japonica  1512 98.90% 0.00% 0.40% 0.73% NA
Aus  269 73.20% 0.00% 11.52% 15.24% NA
Indica I  595 26.10% 1.00% 16.30% 56.64% NA
Indica II  465 20.20% 37.80% 16.56% 25.38% NA
Indica III  913 18.90% 12.90% 2.96% 65.17% NA
Indica Intermediate  786 19.20% 18.10% 16.28% 46.44% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 99.20% 0.00% 0.20% 0.60% NA
Japonica Intermediate  241 95.40% 0.00% 2.07% 2.49% NA
VI/Aromatic  96 97.90% 1.00% 0.00% 1.04% NA
Intermediate  90 73.30% 10.00% 4.44% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0119703755 T -> A LOC_Os01g35600.1 intron_variant ; MODIFIER silent_mutation Average:34.939; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N
vg0119703755 T -> DEL N N silent_mutation Average:34.939; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0119703755 NA 2.89E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119703755 NA 1.45E-09 mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119703755 6.12E-06 6.11E-06 mr1762 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119703755 NA 7.61E-06 mr1058_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119703755 NA 8.72E-07 mr1088_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119703755 NA 1.86E-07 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119703755 NA 4.48E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119703755 NA 6.39E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119703755 NA 6.05E-06 mr1320_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119703755 NA 4.02E-06 mr1388_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119703755 NA 1.38E-07 mr1402_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119703755 4.68E-06 8.98E-08 mr1407_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119703755 NA 8.45E-06 mr1407_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119703755 NA 4.66E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119703755 NA 8.27E-06 mr1469_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119703755 NA 3.02E-07 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119703755 NA 5.68E-07 mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119703755 NA 2.87E-06 mr1554_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119703755 NA 2.48E-09 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119703755 8.96E-06 1.67E-07 mr1762_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119703755 NA 3.35E-07 mr1862_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119703755 NA 1.39E-07 mr1949_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251