Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119699388:

Variant ID: vg0119699388 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 19699388
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAGGATATGCTATTGAAAAAGTGTGGCAAGCCACAACTGTGGCAGTGAACCAAACACATGCTTAACAAACTGTGGTAGCCACAAGTGTGGTGTGGCAAA[G/A]
TGTGGCCATGAACCAAACGCCCCCTAAGATTTTTCCTCAGATCTGGTTCAATTTTAGGGGGATTGATTGGTTGATTATTGGGGAATTGATTCATAGTGTT

Reverse complement sequence

AACACTATGAATCAATTCCCCAATAATCAACCAATCAATCCCCCTAAAATTGAACCAGATCTGAGGAAAAATCTTAGGGGGCGTTTGGTTCATGGCCACA[C/T]
TTTGCCACACCACACTTGTGGCTACCACAGTTTGTTAAGCATGTGTTTGGTTCACTGCCACAGTTGTGGCTTGCCACACTTTTTCAATAGCATATCCTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.30%	0.10%	2.12%	28.48%	NA
All Indica	2759	49.40%	0.20%	3.23%	47.19%	NA
All Japonica	1512	99.20%	0.00%	0.13%	0.66%	NA
Aus	269	88.10%	0.40%	2.60%	8.92%	NA
Indica I	595	47.40%	0.00%	4.54%	48.07%	NA
Indica II	465	72.90%	0.40%	1.51%	25.16%	NA
Indica III	913	35.70%	0.20%	2.30%	61.77%	NA
Indica Intermediate	786	52.80%	0.30%	4.33%	42.62%	NA
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	99.40%	0.00%	0.00%	0.60%	NA
Japonica Intermediate	241	97.10%	0.00%	0.83%	2.07%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	87.80%	0.00%	1.11%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0119699388	G -> A	LOC_Os01g35600.1	downstream_gene_variant ; 3768.0bp to feature; MODIFIER	silent_mutation	Average:51.26; most accessible tissue: Minghui63 young leaf, score: 78.443	N	N	N	N
vg0119699388	G -> A	LOC_Os01g35590-LOC_Os01g35600	intergenic_region ; MODIFIER	silent_mutation	Average:51.26; most accessible tissue: Minghui63 young leaf, score: 78.443	N	N	N	N
vg0119699388	G -> DEL	N	N	silent_mutation	Average:51.26; most accessible tissue: Minghui63 young leaf, score: 78.443	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0119699388	NA	2.22E-06	mr1041_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119699388	NA	3.60E-06	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119699388	NA	2.84E-06	mr1175_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119699388	NA	4.71E-06	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119699388	NA	5.82E-06	mr1299_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119699388	NA	1.31E-06	mr1422_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119699388	NA	4.32E-06	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119699388	NA	2.41E-06	mr1702_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119699388	1.81E-06	1.81E-06	mr1727_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119699388	NA	3.68E-06	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119699388	NA	5.96E-06	mr1814_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119699388	NA	4.20E-06	mr1824_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119699388	NA	4.85E-06	mr1954_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251