\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119699388:

Variant ID: vg0119699388 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 19699388
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAGGATATGCTATTGAAAAAGTGTGGCAAGCCACAACTGTGGCAGTGAACCAAACACATGCTTAACAAACTGTGGTAGCCACAAGTGTGGTGTGGCAAA[G/A]
TGTGGCCATGAACCAAACGCCCCCTAAGATTTTTCCTCAGATCTGGTTCAATTTTAGGGGGATTGATTGGTTGATTATTGGGGAATTGATTCATAGTGTT

Reverse complement sequence

AACACTATGAATCAATTCCCCAATAATCAACCAATCAATCCCCCTAAAATTGAACCAGATCTGAGGAAAAATCTTAGGGGGCGTTTGGTTCATGGCCACA[C/T]
TTTGCCACACCACACTTGTGGCTACCACAGTTTGTTAAGCATGTGTTTGGTTCACTGCCACAGTTGTGGCTTGCCACACTTTTTCAATAGCATATCCTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.30% 0.10% 2.12% 28.48% NA
All Indica  2759 49.40% 0.20% 3.23% 47.19% NA
All Japonica  1512 99.20% 0.00% 0.13% 0.66% NA
Aus  269 88.10% 0.40% 2.60% 8.92% NA
Indica I  595 47.40% 0.00% 4.54% 48.07% NA
Indica II  465 72.90% 0.40% 1.51% 25.16% NA
Indica III  913 35.70% 0.20% 2.30% 61.77% NA
Indica Intermediate  786 52.80% 0.30% 4.33% 42.62% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 99.40% 0.00% 0.00% 0.60% NA
Japonica Intermediate  241 97.10% 0.00% 0.83% 2.07% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 87.80% 0.00% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0119699388 G -> A LOC_Os01g35600.1 downstream_gene_variant ; 3768.0bp to feature; MODIFIER silent_mutation Average:51.26; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N
vg0119699388 G -> A LOC_Os01g35590-LOC_Os01g35600 intergenic_region ; MODIFIER silent_mutation Average:51.26; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N
vg0119699388 G -> DEL N N silent_mutation Average:51.26; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0119699388 NA 2.22E-06 mr1041_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119699388 NA 3.60E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119699388 NA 2.84E-06 mr1175_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119699388 NA 4.71E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119699388 NA 5.82E-06 mr1299_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119699388 NA 1.31E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119699388 NA 4.32E-06 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119699388 NA 2.41E-06 mr1702_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119699388 1.81E-06 1.81E-06 mr1727_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119699388 NA 3.68E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119699388 NA 5.96E-06 mr1814_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119699388 NA 4.20E-06 mr1824_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119699388 NA 4.85E-06 mr1954_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251