\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119676181:

Variant ID: vg0119676181 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 19676181
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGCAACTTTTTTGACAAGTTGACAAGCACGATCGCAGCACCTTAAGCCTTGCGGTGATCCTAGAGTCGCCAACCACCTCAATCTAGCAAAGAGCTAAA[C/T]
CTAGATGGGTTTTGATAACTAAACCAGCTAGCGGAGCCGATTTCTAGATAACTACCTGTCTCGTGGGCAAAACGGAAGGATTTCAGGACAAACCTACAAA

Reverse complement sequence

TTTGTAGGTTTGTCCTGAAATCCTTCCGTTTTGCCCACGAGACAGGTAGTTATCTAGAAATCGGCTCCGCTAGCTGGTTTAGTTATCAAAACCCATCTAG[G/A]
TTTAGCTCTTTGCTAGATTGAGGTGGTTGGCGACTCTAGGATCACCGCAAGGCTTAAGGTGCTGCGATCGTGCTTGTCAACTTGTCAAAAAAGTTGCCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.50% 9.50% 6.96% 0.00% NA
All Indica  2759 74.20% 15.10% 10.69% 0.00% NA
All Japonica  1512 97.90% 1.50% 0.60% 0.00% NA
Aus  269 91.40% 0.40% 8.18% 0.00% NA
Indica I  595 81.70% 3.50% 14.79% 0.00% NA
Indica II  465 46.20% 37.60% 16.13% 0.00% NA
Indica III  913 88.50% 8.50% 2.96% 0.00% NA
Indica Intermediate  786 68.40% 18.20% 13.36% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 95.20% 4.00% 0.79% 0.00% NA
Japonica Intermediate  241 97.50% 0.80% 1.66% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 10.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0119676181 C -> T LOC_Os01g35560.1 upstream_gene_variant ; 166.0bp to feature; MODIFIER silent_mutation Average:48.831; most accessible tissue: Minghui63 flag leaf, score: 72.472 N N N N
vg0119676181 C -> T LOC_Os01g35560-LOC_Os01g35580 intergenic_region ; MODIFIER silent_mutation Average:48.831; most accessible tissue: Minghui63 flag leaf, score: 72.472 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0119676181 NA 4.05E-06 mr1175_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119676181 NA 5.29E-06 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119676181 NA 1.19E-09 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119676181 NA 8.28E-06 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119676181 NA 7.05E-06 mr1320_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119676181 NA 6.08E-09 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119676181 NA 1.73E-12 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119676181 NA 3.57E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119676181 NA 4.64E-06 mr1358_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119676181 NA 8.16E-07 mr1388_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119676181 NA 7.14E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119676181 NA 1.51E-11 mr1428_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119676181 NA 2.66E-09 mr1428_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119676181 NA 6.95E-07 mr1438_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119676181 NA 2.27E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119676181 NA 1.04E-09 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119676181 NA 3.76E-06 mr1882_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251