\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119648489:

Variant ID: vg0119648489 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 19648489
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, C: 0.09, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


AAGCAACCAATTCATCTTGTGGGCCGATTGATGAGTTCCACAAATTCCTTCATATACCTCTCCCATAGCCACTTTAGATTGATTTTCATCTAGGCACTTC[C/A]
ACAAGACACCATCTATATTTTGGCGATACAAATCTCCATCAAGCAATGTATATTTGAACGCTTGCCGCCGAATTTTCCGATCAACCTTGAGTGTAGGATC

Reverse complement sequence

GATCCTACACTCAAGGTTGATCGGAAAATTCGGCGGCAAGCGTTCAAATATACATTGCTTGATGGAGATTTGTATCGCCAAAATATAGATGGTGTCTTGT[G/T]
GAAGTGCCTAGATGAAAATCAATCTAAAGTGGCTATGGGAGAGGTATATGAAGGAATTTGTGGAACTCATCAATCGGCCCACAAGATGAATTGGTTGCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.70% 24.80% 1.88% 6.67% NA
All Indica  2759 45.30% 42.10% 2.72% 9.82% NA
All Japonica  1512 99.30% 0.00% 0.33% 0.33% NA
Aus  269 84.40% 0.00% 2.23% 13.38% NA
Indica I  595 41.80% 42.90% 3.36% 11.93% NA
Indica II  465 73.50% 7.50% 3.23% 15.70% NA
Indica III  913 28.70% 67.30% 1.31% 2.74% NA
Indica Intermediate  786 50.60% 32.80% 3.56% 12.98% NA
Temperate Japonica  767 99.70% 0.00% 0.13% 0.13% NA
Tropical Japonica  504 99.40% 0.00% 0.00% 0.60% NA
Japonica Intermediate  241 97.90% 0.00% 1.66% 0.41% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 84.40% 8.90% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0119648489 C -> A LOC_Os01g35504.1 missense_variant ; p.Trp572Leu; MODERATE nonsynonymous_codon ; W572L Average:49.633; most accessible tissue: Minghui63 flag leaf, score: 64.867 probably damaging -3.757 TOLERATED 1.00
vg0119648489 C -> DEL LOC_Os01g35504.1 N frameshift_variant Average:49.633; most accessible tissue: Minghui63 flag leaf, score: 64.867 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0119648489 NA 3.66E-06 mr1519 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119648489 NA 5.83E-06 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119648489 NA 1.46E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119648489 NA 7.41E-07 mr1175_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119648489 NA 6.78E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119648489 NA 4.80E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119648489 NA 2.86E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119648489 NA 2.65E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119648489 NA 7.88E-07 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119648489 NA 9.67E-07 mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119648489 NA 9.11E-07 mr1517_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119648489 NA 6.25E-09 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119648489 NA 8.89E-06 mr1702_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119648489 NA 2.60E-06 mr1882_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119648489 NA 4.52E-06 mr1882_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119648489 NA 2.28E-06 mr1954_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119648489 NA 1.24E-06 mr1954_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119648489 NA 7.79E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251