\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119495785:

Variant ID: vg0119495785 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 19495785
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGGCAGCGCCGAAAGTTGATAGTGACAACTCGAGCTGCCGCATTTCATGTGTGCTGTTGTGCACTGTGCGCGCTACTGGATCTGACACTACCGTGAAGG[G/A]
CCGAAAGTGTGTTGTCGTGAGCATAAGTTGTTCTAGCACCATATGAATGAAAAGAACTATGTAGACGAGACAAACACAAGTAGTACTGCAGTAGTAATAG

Reverse complement sequence

CTATTACTACTGCAGTACTACTTGTGTTTGTCTCGTCTACATAGTTCTTTTCATTCATATGGTGCTAGAACAACTTATGCTCACGACAACACACTTTCGG[C/T]
CCTTCACGGTAGTGTCAGATCCAGTAGCGCGCACAGTGCACAACAGCACACATGAAATGCGGCAGCTCGAGTTGTCACTATCAACTTTCGGCGCTGCCTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.20% 10.60% 8.87% 8.36% NA
All Indica  2759 56.40% 18.10% 12.03% 13.52% NA
All Japonica  1512 95.70% 0.00% 3.70% 0.60% NA
Aus  269 86.60% 0.00% 10.04% 3.35% NA
Indica I  595 55.10% 13.60% 7.56% 23.70% NA
Indica II  465 62.20% 13.10% 8.17% 16.56% NA
Indica III  913 53.90% 19.80% 19.06% 7.23% NA
Indica Intermediate  786 56.70% 22.40% 9.54% 11.32% NA
Temperate Japonica  767 98.20% 0.00% 1.83% 0.00% NA
Tropical Japonica  504 94.80% 0.00% 4.76% 0.40% NA
Japonica Intermediate  241 89.60% 0.00% 7.47% 2.90% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 2.20% 4.44% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0119495785 G -> A LOC_Os01g35210.1 downstream_gene_variant ; 2913.0bp to feature; MODIFIER silent_mutation Average:37.259; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N
vg0119495785 G -> A LOC_Os01g35220.1 intron_variant ; MODIFIER silent_mutation Average:37.259; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N
vg0119495785 G -> DEL N N silent_mutation Average:37.259; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0119495785 NA 2.37E-08 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119495785 NA 1.18E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119495785 NA 7.15E-09 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119495785 NA 2.92E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119495785 NA 2.06E-08 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119495785 NA 3.32E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119495785 NA 2.59E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119495785 NA 6.66E-07 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119495785 NA 1.33E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119495785 NA 1.09E-06 mr1442_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119495785 NA 2.17E-07 mr1442_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119495785 NA 7.67E-06 mr1469_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119495785 NA 1.56E-09 mr1510_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119495785 NA 1.40E-06 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119495785 NA 5.69E-07 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119495785 NA 6.43E-07 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119495785 4.77E-06 1.17E-06 mr1702_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119495785 5.84E-06 1.89E-08 mr1702_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119495785 NA 2.64E-08 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119495785 NA 1.24E-07 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119495785 NA 2.45E-06 mr1882_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119495785 NA 5.03E-06 mr1882_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119495785 NA 2.13E-07 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251