\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119476565:

Variant ID: vg0119476565 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 19476565
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


CCGCCAGTGATGAACTCCAAGATTATAAATATCTTCTTCCGGCTTGCCAAGACCTGCACATAACAGAACAGATATGATCACCCAATCAGCACTTGGAAAA[A/G]
GCAAGAGAGAACAAAGAAGTAAACAACAAAACTTAAAGAGAGAAAAGGGAAAGAGGGTGTACTTCGTGTAGTCTAACCACATTCGGATGCCTCACAAGCT

Reverse complement sequence

AGCTTGTGAGGCATCCGAATGTGGTTAGACTACACGAAGTACACCCTCTTTCCCTTTTCTCTCTTTAAGTTTTGTTGTTTACTTCTTTGTTCTCTCTTGC[T/C]
TTTTCCAAGTGCTGATTGGGTGATCATATCTGTTCTGTTATGTGCAGGTCTTGGCAAGCCGGAAGAAGATATTTATAATCTTGGAGTTCATCACTGGCGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.80% 42.10% 0.02% 0.00% NA
All Indica  2759 29.80% 70.10% 0.04% 0.00% NA
All Japonica  1512 99.20% 0.80% 0.00% 0.00% NA
Aus  269 91.80% 8.20% 0.00% 0.00% NA
Indica I  595 9.70% 90.30% 0.00% 0.00% NA
Indica II  465 50.80% 49.00% 0.22% 0.00% NA
Indica III  913 27.20% 72.80% 0.00% 0.00% NA
Indica Intermediate  786 35.80% 64.20% 0.00% 0.00% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0119476565 A -> G LOC_Os01g35200.1 upstream_gene_variant ; 4099.0bp to feature; MODIFIER silent_mutation Average:72.13; most accessible tissue: Minghui63 flag leaf, score: 88.687 N N N N
vg0119476565 A -> G LOC_Os01g35184.1 intron_variant ; MODIFIER silent_mutation Average:72.13; most accessible tissue: Minghui63 flag leaf, score: 88.687 N N N N
vg0119476565 A -> G LOC_Os01g35184.2 intron_variant ; MODIFIER silent_mutation Average:72.13; most accessible tissue: Minghui63 flag leaf, score: 88.687 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0119476565 A G 0.02 -0.01 -0.02 -0.01 0.0 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0119476565 NA 7.10E-11 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119476565 NA 1.26E-06 mr1702 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119476565 NA 3.08E-08 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119476565 NA 5.36E-08 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119476565 NA 3.61E-09 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119476565 NA 4.46E-09 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119476565 NA 6.13E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119476565 NA 8.40E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119476565 NA 2.40E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119476565 NA 5.51E-09 mr1510_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119476565 NA 4.76E-06 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119476565 NA 3.64E-06 mr1550_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119476565 NA 9.88E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119476565 NA 1.03E-33 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119476565 NA 6.12E-06 mr1762_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251