\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119464019:

Variant ID: vg0119464019 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 19464019
Reference Allele: TAlternative Allele: A,TA,TAA
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.64, T: 0.36, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCTTCTAAATTATCTGTCCGATCTATGATCTAATTACACAGTTGCATTTCTTATAATTAAATCTTTATAACAAGATCTCACATGCTTATATTTTTTTT[T/A,TA,TAA]
AAAAAAATATAAGTTGCTTCATCACTTATTAAAAAATGTTTCATTACTTGGTCATTATATGTTTAAGTTCACTATATAGCATGTTTCAGAGAGATGCGAC

Reverse complement sequence

GTCGCATCTCTCTGAAACATGCTATATAGTGAACTTAAACATATAATGACCAAGTAATGAAACATTTTTTAATAAGTGATGAAGCAACTTATATTTTTTT[A/T,TA,TTA]
AAAAAAAATATAAGCATGTGAGATCTTGTTATAAAGATTTAATTATAAGAAATGCAACTGTGTAATTAGATCATAGATCGGACAGATAATTTAGAAGAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.30% 43.10% 2.90% 0.08% TAA: 0.44%; TA: 0.15%
All Indica  2759 29.60% 68.00% 2.10% 0.14% TAA: 0.14%; TA: 0.04%
All Japonica  1512 87.80% 7.60% 4.23% 0.00% TA: 0.40%
Aus  269 87.70% 3.30% 2.60% 0.00% TAA: 6.32%
Indica I  595 9.60% 89.70% 0.67% 0.00% NA
Indica II  465 49.20% 47.30% 3.01% 0.43% NA
Indica III  913 28.00% 70.50% 1.31% 0.00% TA: 0.11%
Indica Intermediate  786 34.90% 60.80% 3.56% 0.25% TAA: 0.51%
Temperate Japonica  767 81.50% 11.30% 6.39% 0.00% TA: 0.78%
Tropical Japonica  504 94.80% 3.40% 1.79% 0.00% NA
Japonica Intermediate  241 92.90% 4.60% 2.49% 0.00% NA
VI/Aromatic  96 78.10% 18.80% 3.12% 0.00% NA
Intermediate  90 71.10% 23.30% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0119464019 T -> TA LOC_Os01g35170.1 upstream_gene_variant ; 2254.0bp to feature; MODIFIER silent_mutation Average:45.44; most accessible tissue: Callus, score: 67.583 N N N N
vg0119464019 T -> TA LOC_Os01g35170.2 upstream_gene_variant ; 2254.0bp to feature; MODIFIER silent_mutation Average:45.44; most accessible tissue: Callus, score: 67.583 N N N N
vg0119464019 T -> TA LOC_Os01g35170.3 upstream_gene_variant ; 2287.0bp to feature; MODIFIER silent_mutation Average:45.44; most accessible tissue: Callus, score: 67.583 N N N N
vg0119464019 T -> TA LOC_Os01g35160-LOC_Os01g35170 intergenic_region ; MODIFIER silent_mutation Average:45.44; most accessible tissue: Callus, score: 67.583 N N N N
vg0119464019 T -> A LOC_Os01g35170.1 upstream_gene_variant ; 2255.0bp to feature; MODIFIER silent_mutation Average:45.44; most accessible tissue: Callus, score: 67.583 N N N N
vg0119464019 T -> A LOC_Os01g35170.2 upstream_gene_variant ; 2255.0bp to feature; MODIFIER silent_mutation Average:45.44; most accessible tissue: Callus, score: 67.583 N N N N
vg0119464019 T -> A LOC_Os01g35170.3 upstream_gene_variant ; 2288.0bp to feature; MODIFIER silent_mutation Average:45.44; most accessible tissue: Callus, score: 67.583 N N N N
vg0119464019 T -> A LOC_Os01g35160-LOC_Os01g35170 intergenic_region ; MODIFIER silent_mutation Average:45.44; most accessible tissue: Callus, score: 67.583 N N N N
vg0119464019 T -> DEL N N silent_mutation Average:45.44; most accessible tissue: Callus, score: 67.583 N N N N
vg0119464019 T -> TAA LOC_Os01g35170.1 upstream_gene_variant ; 2254.0bp to feature; MODIFIER silent_mutation Average:45.44; most accessible tissue: Callus, score: 67.583 N N N N
vg0119464019 T -> TAA LOC_Os01g35170.2 upstream_gene_variant ; 2254.0bp to feature; MODIFIER silent_mutation Average:45.44; most accessible tissue: Callus, score: 67.583 N N N N
vg0119464019 T -> TAA LOC_Os01g35170.3 upstream_gene_variant ; 2287.0bp to feature; MODIFIER silent_mutation Average:45.44; most accessible tissue: Callus, score: 67.583 N N N N
vg0119464019 T -> TAA LOC_Os01g35160-LOC_Os01g35170 intergenic_region ; MODIFIER silent_mutation Average:45.44; most accessible tissue: Callus, score: 67.583 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0119464019 NA 4.57E-09 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119464019 NA 9.49E-07 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119464019 NA 5.61E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119464019 1.61E-06 5.32E-06 mr1648 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119464019 7.05E-06 7.84E-06 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119464019 NA 1.64E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119464019 NA 8.01E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119464019 NA 2.09E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119464019 NA 8.23E-06 mr1901_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251