\
| Variant ID: vg0119464019 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr01 | Position: 19464019 |
| Reference Allele: T | Alternative Allele: A,TA,TAA |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.64, T: 0.36, others allele: 0.00, population size: 78. )
TTTCTTCTAAATTATCTGTCCGATCTATGATCTAATTACACAGTTGCATTTCTTATAATTAAATCTTTATAACAAGATCTCACATGCTTATATTTTTTTT[T/A,TA,TAA]
AAAAAAATATAAGTTGCTTCATCACTTATTAAAAAATGTTTCATTACTTGGTCATTATATGTTTAAGTTCACTATATAGCATGTTTCAGAGAGATGCGAC
GTCGCATCTCTCTGAAACATGCTATATAGTGAACTTAAACATATAATGACCAAGTAATGAAACATTTTTTAATAAGTGATGAAGCAACTTATATTTTTTT[A/T,TA,TTA]
AAAAAAAATATAAGCATGTGAGATCTTGTTATAAAGATTTAATTATAAGAAATGCAACTGTGTAATTAGATCATAGATCGGACAGATAATTTAGAAGAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.30% | 43.10% | 2.90% | 0.08% | TAA: 0.44%; TA: 0.15% |
| All Indica | 2759 | 29.60% | 68.00% | 2.10% | 0.14% | TAA: 0.14%; TA: 0.04% |
| All Japonica | 1512 | 87.80% | 7.60% | 4.23% | 0.00% | TA: 0.40% |
| Aus | 269 | 87.70% | 3.30% | 2.60% | 0.00% | TAA: 6.32% |
| Indica I | 595 | 9.60% | 89.70% | 0.67% | 0.00% | NA |
| Indica II | 465 | 49.20% | 47.30% | 3.01% | 0.43% | NA |
| Indica III | 913 | 28.00% | 70.50% | 1.31% | 0.00% | TA: 0.11% |
| Indica Intermediate | 786 | 34.90% | 60.80% | 3.56% | 0.25% | TAA: 0.51% |
| Temperate Japonica | 767 | 81.50% | 11.30% | 6.39% | 0.00% | TA: 0.78% |
| Tropical Japonica | 504 | 94.80% | 3.40% | 1.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.90% | 4.60% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 78.10% | 18.80% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 23.30% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0119464019 | T -> TA | LOC_Os01g35170.1 | upstream_gene_variant ; 2254.0bp to feature; MODIFIER | silent_mutation | Average:45.44; most accessible tissue: Callus, score: 67.583 | N | N | N | N |
| vg0119464019 | T -> TA | LOC_Os01g35170.2 | upstream_gene_variant ; 2254.0bp to feature; MODIFIER | silent_mutation | Average:45.44; most accessible tissue: Callus, score: 67.583 | N | N | N | N |
| vg0119464019 | T -> TA | LOC_Os01g35170.3 | upstream_gene_variant ; 2287.0bp to feature; MODIFIER | silent_mutation | Average:45.44; most accessible tissue: Callus, score: 67.583 | N | N | N | N |
| vg0119464019 | T -> TA | LOC_Os01g35160-LOC_Os01g35170 | intergenic_region ; MODIFIER | silent_mutation | Average:45.44; most accessible tissue: Callus, score: 67.583 | N | N | N | N |
| vg0119464019 | T -> A | LOC_Os01g35170.1 | upstream_gene_variant ; 2255.0bp to feature; MODIFIER | silent_mutation | Average:45.44; most accessible tissue: Callus, score: 67.583 | N | N | N | N |
| vg0119464019 | T -> A | LOC_Os01g35170.2 | upstream_gene_variant ; 2255.0bp to feature; MODIFIER | silent_mutation | Average:45.44; most accessible tissue: Callus, score: 67.583 | N | N | N | N |
| vg0119464019 | T -> A | LOC_Os01g35170.3 | upstream_gene_variant ; 2288.0bp to feature; MODIFIER | silent_mutation | Average:45.44; most accessible tissue: Callus, score: 67.583 | N | N | N | N |
| vg0119464019 | T -> A | LOC_Os01g35160-LOC_Os01g35170 | intergenic_region ; MODIFIER | silent_mutation | Average:45.44; most accessible tissue: Callus, score: 67.583 | N | N | N | N |
| vg0119464019 | T -> DEL | N | N | silent_mutation | Average:45.44; most accessible tissue: Callus, score: 67.583 | N | N | N | N |
| vg0119464019 | T -> TAA | LOC_Os01g35170.1 | upstream_gene_variant ; 2254.0bp to feature; MODIFIER | silent_mutation | Average:45.44; most accessible tissue: Callus, score: 67.583 | N | N | N | N |
| vg0119464019 | T -> TAA | LOC_Os01g35170.2 | upstream_gene_variant ; 2254.0bp to feature; MODIFIER | silent_mutation | Average:45.44; most accessible tissue: Callus, score: 67.583 | N | N | N | N |
| vg0119464019 | T -> TAA | LOC_Os01g35170.3 | upstream_gene_variant ; 2287.0bp to feature; MODIFIER | silent_mutation | Average:45.44; most accessible tissue: Callus, score: 67.583 | N | N | N | N |
| vg0119464019 | T -> TAA | LOC_Os01g35160-LOC_Os01g35170 | intergenic_region ; MODIFIER | silent_mutation | Average:45.44; most accessible tissue: Callus, score: 67.583 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0119464019 | NA | 4.57E-09 | mr1565 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119464019 | NA | 9.49E-07 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119464019 | NA | 5.61E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119464019 | 1.61E-06 | 5.32E-06 | mr1648 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119464019 | 7.05E-06 | 7.84E-06 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119464019 | NA | 1.64E-06 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119464019 | NA | 8.01E-07 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119464019 | NA | 2.09E-06 | mr1428_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119464019 | NA | 8.23E-06 | mr1901_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |