Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119464019:

Variant ID: vg0119464019 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 19464019
Reference Allele: T	Alternative Allele: A,TA,TAA
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.64, T: 0.36, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

TTTCTTCTAAATTATCTGTCCGATCTATGATCTAATTACACAGTTGCATTTCTTATAATTAAATCTTTATAACAAGATCTCACATGCTTATATTTTTTTT[T/A,TA,TAA]
AAAAAAATATAAGTTGCTTCATCACTTATTAAAAAATGTTTCATTACTTGGTCATTATATGTTTAAGTTCACTATATAGCATGTTTCAGAGAGATGCGAC

Reverse complement sequence

GTCGCATCTCTCTGAAACATGCTATATAGTGAACTTAAACATATAATGACCAAGTAATGAAACATTTTTTAATAAGTGATGAAGCAACTTATATTTTTTT[A/T,TA,TTA]
AAAAAAAATATAAGCATGTGAGATCTTGTTATAAAGATTTAATTATAAGAAATGCAACTGTGTAATTAGATCATAGATCGGACAGATAATTTAGAAGAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.30%	43.10%	2.90%	0.08%	TAA: 0.44%; TA: 0.15%
All Indica	2759	29.60%	68.00%	2.10%	0.14%	TAA: 0.14%; TA: 0.04%
All Japonica	1512	87.80%	7.60%	4.23%	0.00%	TA: 0.40%
Aus	269	87.70%	3.30%	2.60%	0.00%	TAA: 6.32%
Indica I	595	9.60%	89.70%	0.67%	0.00%	NA
Indica II	465	49.20%	47.30%	3.01%	0.43%	NA
Indica III	913	28.00%	70.50%	1.31%	0.00%	TA: 0.11%
Indica Intermediate	786	34.90%	60.80%	3.56%	0.25%	TAA: 0.51%
Temperate Japonica	767	81.50%	11.30%	6.39%	0.00%	TA: 0.78%
Tropical Japonica	504	94.80%	3.40%	1.79%	0.00%	NA
Japonica Intermediate	241	92.90%	4.60%	2.49%	0.00%	NA
VI/Aromatic	96	78.10%	18.80%	3.12%	0.00%	NA
Intermediate	90	71.10%	23.30%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0119464019	T -> TA	LOC_Os01g35170.1	upstream_gene_variant ; 2254.0bp to feature; MODIFIER	silent_mutation	Average:45.44; most accessible tissue: Callus, score: 67.583	N	N	N	N
vg0119464019	T -> TA	LOC_Os01g35170.2	upstream_gene_variant ; 2254.0bp to feature; MODIFIER	silent_mutation	Average:45.44; most accessible tissue: Callus, score: 67.583	N	N	N	N
vg0119464019	T -> TA	LOC_Os01g35170.3	upstream_gene_variant ; 2287.0bp to feature; MODIFIER	silent_mutation	Average:45.44; most accessible tissue: Callus, score: 67.583	N	N	N	N
vg0119464019	T -> TA	LOC_Os01g35160-LOC_Os01g35170	intergenic_region ; MODIFIER	silent_mutation	Average:45.44; most accessible tissue: Callus, score: 67.583	N	N	N	N
vg0119464019	T -> A	LOC_Os01g35170.1	upstream_gene_variant ; 2255.0bp to feature; MODIFIER	silent_mutation	Average:45.44; most accessible tissue: Callus, score: 67.583	N	N	N	N
vg0119464019	T -> A	LOC_Os01g35170.2	upstream_gene_variant ; 2255.0bp to feature; MODIFIER	silent_mutation	Average:45.44; most accessible tissue: Callus, score: 67.583	N	N	N	N
vg0119464019	T -> A	LOC_Os01g35170.3	upstream_gene_variant ; 2288.0bp to feature; MODIFIER	silent_mutation	Average:45.44; most accessible tissue: Callus, score: 67.583	N	N	N	N
vg0119464019	T -> A	LOC_Os01g35160-LOC_Os01g35170	intergenic_region ; MODIFIER	silent_mutation	Average:45.44; most accessible tissue: Callus, score: 67.583	N	N	N	N
vg0119464019	T -> DEL	N	N	silent_mutation	Average:45.44; most accessible tissue: Callus, score: 67.583	N	N	N	N
vg0119464019	T -> TAA	LOC_Os01g35170.1	upstream_gene_variant ; 2254.0bp to feature; MODIFIER	silent_mutation	Average:45.44; most accessible tissue: Callus, score: 67.583	N	N	N	N
vg0119464019	T -> TAA	LOC_Os01g35170.2	upstream_gene_variant ; 2254.0bp to feature; MODIFIER	silent_mutation	Average:45.44; most accessible tissue: Callus, score: 67.583	N	N	N	N
vg0119464019	T -> TAA	LOC_Os01g35170.3	upstream_gene_variant ; 2287.0bp to feature; MODIFIER	silent_mutation	Average:45.44; most accessible tissue: Callus, score: 67.583	N	N	N	N
vg0119464019	T -> TAA	LOC_Os01g35160-LOC_Os01g35170	intergenic_region ; MODIFIER	silent_mutation	Average:45.44; most accessible tissue: Callus, score: 67.583	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0119464019	NA	4.57E-09	mr1565	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119464019	NA	9.49E-07	mr1593	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119464019	NA	5.61E-08	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119464019	1.61E-06	5.32E-06	mr1648	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119464019	7.05E-06	7.84E-06	mr1697	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119464019	NA	1.64E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119464019	NA	8.01E-07	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119464019	NA	2.09E-06	mr1428_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119464019	NA	8.23E-06	mr1901_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251