Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119414733:

Variant ID: vg0119414733 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 19414733
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

AGATCGATCCATCCAAAACGAACGGCCGGGATCTATCGGCCCACGACCGGTCCACGGGACATGGCGACGATGACGTCGGCGATGACGTCATCACCGGCGG[C/T]
GGCTCGGGCGCGCAAGCTTGCCGGCGAACGACGACACGACGGCGCTAACGAAGGACACCAAAACGATGCGGGCGACGCGGCGAACTCACCGGTGACCAAA

Reverse complement sequence

TTTGGTCACCGGTGAGTTCGCCGCGTCGCCCGCATCGTTTTGGTGTCCTTCGTTAGCGCCGTCGTGTCGTCGTTCGCCGGCAAGCTTGCGCGCCCGAGCC[G/A]
CCGCCGGTGATGACGTCATCGCCGACGTCATCGTCGCCATGTCCCGTGGACCGGTCGTGGGCCGATAGATCCCGGCCGTTCGTTTTGGATGGATCGATCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.90%	18.40%	0.93%	2.84%	NA
All Indica	2759	63.40%	30.70%	1.09%	4.82%	NA
All Japonica	1512	99.20%	0.80%	0.00%	0.00%	NA
Aus	269	95.20%	0.00%	4.83%	0.00%	NA
Indica I	595	79.80%	8.40%	2.35%	9.41%	NA
Indica II	465	89.20%	4.10%	1.08%	5.59%	NA
Indica III	913	35.50%	62.50%	0.33%	1.64%	NA
Indica Intermediate	786	67.90%	26.50%	1.02%	4.58%	NA
Temperate Japonica	767	98.40%	1.60%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	7.80%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0119414733	C -> T	LOC_Os01g35070.1	downstream_gene_variant ; 1146.0bp to feature; MODIFIER	silent_mutation	Average:46.443; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0119414733	C -> T	LOC_Os01g35050-LOC_Os01g35070	intergenic_region ; MODIFIER	silent_mutation	Average:46.443; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0119414733	C -> DEL	N	N	silent_mutation	Average:46.443; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0119414733	NA	3.13E-09	mr1065	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733	NA	5.03E-09	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733	NA	2.65E-07	mr1078	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733	NA	7.01E-08	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733	NA	1.69E-08	mr1112	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733	NA	3.72E-08	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733	NA	3.51E-08	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733	NA	4.10E-08	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733	NA	4.83E-06	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733	NA	5.15E-06	mr1192	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733	NA	8.59E-07	mr1200	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733	4.76E-06	1.20E-06	mr1212	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733	9.13E-06	6.69E-09	mr1212	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733	NA	6.68E-09	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733	NA	3.38E-07	mr1237	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733	NA	6.63E-08	mr1244	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733	NA	1.67E-06	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733	NA	1.51E-06	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733	NA	1.95E-06	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251