\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119414733:

Variant ID: vg0119414733 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 19414733
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


AGATCGATCCATCCAAAACGAACGGCCGGGATCTATCGGCCCACGACCGGTCCACGGGACATGGCGACGATGACGTCGGCGATGACGTCATCACCGGCGG[C/T]
GGCTCGGGCGCGCAAGCTTGCCGGCGAACGACGACACGACGGCGCTAACGAAGGACACCAAAACGATGCGGGCGACGCGGCGAACTCACCGGTGACCAAA

Reverse complement sequence

TTTGGTCACCGGTGAGTTCGCCGCGTCGCCCGCATCGTTTTGGTGTCCTTCGTTAGCGCCGTCGTGTCGTCGTTCGCCGGCAAGCTTGCGCGCCCGAGCC[G/A]
CCGCCGGTGATGACGTCATCGCCGACGTCATCGTCGCCATGTCCCGTGGACCGGTCGTGGGCCGATAGATCCCGGCCGTTCGTTTTGGATGGATCGATCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.90% 18.40% 0.93% 2.84% NA
All Indica  2759 63.40% 30.70% 1.09% 4.82% NA
All Japonica  1512 99.20% 0.80% 0.00% 0.00% NA
Aus  269 95.20% 0.00% 4.83% 0.00% NA
Indica I  595 79.80% 8.40% 2.35% 9.41% NA
Indica II  465 89.20% 4.10% 1.08% 5.59% NA
Indica III  913 35.50% 62.50% 0.33% 1.64% NA
Indica Intermediate  786 67.90% 26.50% 1.02% 4.58% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 90.00% 7.80% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0119414733 C -> T LOC_Os01g35070.1 downstream_gene_variant ; 1146.0bp to feature; MODIFIER silent_mutation Average:46.443; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0119414733 C -> T LOC_Os01g35050-LOC_Os01g35070 intergenic_region ; MODIFIER silent_mutation Average:46.443; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0119414733 C -> DEL N N silent_mutation Average:46.443; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0119414733 NA 3.13E-09 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733 NA 5.03E-09 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733 NA 2.65E-07 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733 NA 7.01E-08 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733 NA 1.69E-08 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733 NA 3.72E-08 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733 NA 3.51E-08 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733 NA 4.10E-08 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733 NA 4.83E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733 NA 5.15E-06 mr1192 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733 NA 8.59E-07 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733 4.76E-06 1.20E-06 mr1212 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733 9.13E-06 6.69E-09 mr1212 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733 NA 6.68E-09 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733 NA 3.38E-07 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733 NA 6.63E-08 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733 NA 1.67E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733 NA 1.51E-06 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119414733 NA 1.95E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251