\
| Variant ID: vg0119413705 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 19413705 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CCTCGGAAAGGAGCTGTGACAGTACCCCTCGCACAACACAATCCACCACAGCGCACCGTTCCTGGATCATAATCACCCCCTTATAAACAAGGCATGTACT[T/C]
CCCAGCGACCCCCGTGGGCTTATCTCCGCCACTTCTCAGTCTGGTGCTCCGTAATGAACCATGCTATACAAAAGGTAAAGCCGTTGCCCACGCTGGCTTG
CAAGCCAGCGTGGGCAACGGCTTTACCTTTTGTATAGCATGGTTCATTACGGAGCACCAGACTGAGAAGTGGCGGAGATAAGCCCACGGGGGTCGCTGGG[A/G]
AGTACATGCCTTGTTTATAAGGGGGTGATTATGATCCAGGAACGGTGCGCTGTGGTGGATTGTGTTGTGCGAGGGGTACTGTCACAGCTCCTTTCCGAGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.90% | 1.70% | 24.44% | 11.93% | NA |
| All Indica | 2759 | 36.30% | 2.90% | 40.49% | 20.30% | NA |
| All Japonica | 1512 | 99.50% | 0.00% | 0.53% | 0.00% | NA |
| Aus | 269 | 93.30% | 0.40% | 6.32% | 0.00% | NA |
| Indica I | 595 | 12.30% | 3.50% | 56.13% | 28.07% | NA |
| Indica II | 465 | 64.30% | 2.80% | 27.96% | 4.95% | NA |
| Indica III | 913 | 33.60% | 2.00% | 38.99% | 25.41% | NA |
| Indica Intermediate | 786 | 41.10% | 3.60% | 37.79% | 17.56% | NA |
| Temperate Japonica | 767 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 0.00% | 13.33% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0119413705 | T -> DEL | N | N | silent_mutation | Average:32.827; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0119413705 | T -> C | LOC_Os01g35070.1 | downstream_gene_variant ; 2174.0bp to feature; MODIFIER | silent_mutation | Average:32.827; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0119413705 | T -> C | LOC_Os01g35050-LOC_Os01g35070 | intergenic_region ; MODIFIER | silent_mutation | Average:32.827; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0119413705 | NA | 1.20E-12 | mr1565 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119413705 | NA | 5.93E-06 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119413705 | NA | 1.48E-07 | mr1072_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119413705 | NA | 2.82E-07 | mr1075_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119413705 | NA | 3.14E-08 | mr1077_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119413705 | NA | 1.08E-06 | mr1232_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119413705 | NA | 9.10E-06 | mr1510_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119413705 | NA | 3.71E-07 | mr1539_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119413705 | NA | 3.45E-09 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119413705 | NA | 1.03E-11 | mr1565_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119413705 | NA | 2.71E-39 | mr1598_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119413705 | NA | 8.91E-11 | mr1598_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119413705 | NA | 1.71E-06 | mr1901_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119413705 | NA | 1.10E-06 | mr1959_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |