\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119413705:

Variant ID: vg0119413705 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 19413705
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTCGGAAAGGAGCTGTGACAGTACCCCTCGCACAACACAATCCACCACAGCGCACCGTTCCTGGATCATAATCACCCCCTTATAAACAAGGCATGTACT[T/C]
CCCAGCGACCCCCGTGGGCTTATCTCCGCCACTTCTCAGTCTGGTGCTCCGTAATGAACCATGCTATACAAAAGGTAAAGCCGTTGCCCACGCTGGCTTG

Reverse complement sequence

CAAGCCAGCGTGGGCAACGGCTTTACCTTTTGTATAGCATGGTTCATTACGGAGCACCAGACTGAGAAGTGGCGGAGATAAGCCCACGGGGGTCGCTGGG[A/G]
AGTACATGCCTTGTTTATAAGGGGGTGATTATGATCCAGGAACGGTGCGCTGTGGTGGATTGTGTTGTGCGAGGGGTACTGTCACAGCTCCTTTCCGAGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.90% 1.70% 24.44% 11.93% NA
All Indica  2759 36.30% 2.90% 40.49% 20.30% NA
All Japonica  1512 99.50% 0.00% 0.53% 0.00% NA
Aus  269 93.30% 0.40% 6.32% 0.00% NA
Indica I  595 12.30% 3.50% 56.13% 28.07% NA
Indica II  465 64.30% 2.80% 27.96% 4.95% NA
Indica III  913 33.60% 2.00% 38.99% 25.41% NA
Indica Intermediate  786 41.10% 3.60% 37.79% 17.56% NA
Temperate Japonica  767 99.00% 0.00% 1.04% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 82.20% 0.00% 13.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0119413705 T -> DEL N N silent_mutation Average:32.827; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0119413705 T -> C LOC_Os01g35070.1 downstream_gene_variant ; 2174.0bp to feature; MODIFIER silent_mutation Average:32.827; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0119413705 T -> C LOC_Os01g35050-LOC_Os01g35070 intergenic_region ; MODIFIER silent_mutation Average:32.827; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0119413705 NA 1.20E-12 mr1565 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119413705 NA 5.93E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119413705 NA 1.48E-07 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119413705 NA 2.82E-07 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119413705 NA 3.14E-08 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119413705 NA 1.08E-06 mr1232_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119413705 NA 9.10E-06 mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119413705 NA 3.71E-07 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119413705 NA 3.45E-09 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119413705 NA 1.03E-11 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119413705 NA 2.71E-39 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119413705 NA 8.91E-11 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119413705 NA 1.71E-06 mr1901_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119413705 NA 1.10E-06 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251