\
| Variant ID: vg0119388504 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 19388504 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 113. )
ATATATATATATATATATATATATATATATATATATATATATATATATATATATCATATGCGCACAAGCTTCTCTTACACACTCCGTACACACCAAATAA[T/C]
AAATGTCATGAAAAACTATACAAAATATTGAACATTTACTCCTAATAGTATTACACATATATGCAAAGTATCATATTCAAATTCACTATATTTTAGCCAT
ATGGCTAAAATATAGTGAATTTGAATATGATACTTTGCATATATGTGTAATACTATTAGGAGTAAATGTTCAATATTTTGTATAGTTTTTCATGACATTT[A/G]
TTATTTGGTGTGTACGGAGTGTGTAAGAGAAGCTTGTGCGCATATGATATATATATATATATATATATATATATATATATATATATATATATATATATAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.10% | 10.10% | 14.11% | 26.62% | NA |
| All Indica | 2759 | 50.60% | 16.40% | 22.98% | 10.04% | NA |
| All Japonica | 1512 | 41.30% | 1.30% | 1.12% | 56.28% | NA |
| Aus | 269 | 73.20% | 0.70% | 2.97% | 23.05% | NA |
| Indica I | 595 | 48.20% | 34.30% | 15.63% | 1.85% | NA |
| Indica II | 465 | 79.80% | 4.30% | 4.95% | 10.97% | NA |
| Indica III | 913 | 32.10% | 15.20% | 38.23% | 14.46% | NA |
| Indica Intermediate | 786 | 56.50% | 11.50% | 21.50% | 10.56% | NA |
| Temperate Japonica | 767 | 63.40% | 0.40% | 1.04% | 35.20% | NA |
| Tropical Japonica | 504 | 15.70% | 2.00% | 1.39% | 80.95% | NA |
| Japonica Intermediate | 241 | 24.90% | 2.50% | 0.83% | 71.78% | NA |
| VI/Aromatic | 96 | 55.20% | 1.00% | 1.04% | 42.71% | NA |
| Intermediate | 90 | 57.80% | 4.40% | 7.78% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0119388504 | T -> DEL | N | N | silent_mutation | Average:29.273; most accessible tissue: Callus, score: 75.052 | N | N | N | N |
| vg0119388504 | T -> C | LOC_Os01g35040.1 | upstream_gene_variant ; 1327.0bp to feature; MODIFIER | silent_mutation | Average:29.273; most accessible tissue: Callus, score: 75.052 | N | N | N | N |
| vg0119388504 | T -> C | LOC_Os01g35030.1 | downstream_gene_variant ; 1306.0bp to feature; MODIFIER | silent_mutation | Average:29.273; most accessible tissue: Callus, score: 75.052 | N | N | N | N |
| vg0119388504 | T -> C | LOC_Os01g35030-LOC_Os01g35040 | intergenic_region ; MODIFIER | silent_mutation | Average:29.273; most accessible tissue: Callus, score: 75.052 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0119388504 | NA | 8.92E-11 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0119388504 | NA | 3.57E-09 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119388504 | NA | 8.96E-07 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119388504 | NA | 3.92E-07 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119388504 | NA | 1.76E-07 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119388504 | NA | 5.13E-09 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119388504 | NA | 4.22E-08 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119388504 | NA | 5.51E-06 | mr1215_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119388504 | NA | 5.65E-07 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119388504 | NA | 4.82E-06 | mr1422_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119388504 | NA | 7.18E-07 | mr1517_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119388504 | NA | 4.19E-07 | mr1519_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119388504 | NA | 6.13E-06 | mr1622_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119388504 | NA | 1.12E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119388504 | NA | 2.96E-06 | mr1954_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119388504 | 3.51E-06 | 3.50E-06 | mr1972_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |