\
| Variant ID: vg0119345769 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 19345769 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 313. )
TAATGAGGATGCCAATGCTCATCTGCAACAGTTCCTGGAGATTTATAGCACGTACACTATCAAGGGCATCAGTCCCGACGCCGTCAGGCTGCGGCTGTTT[C/T]
CGTTCTCCCTCCTCGGGAGAGCAAAGAAGTGGTTCTACGCCAACCGTGCTGCTGTCAATACCTAGGACAAATGCTCTACGGCATTCCTCTCGAAATTTTT
AAAAATTTCGAGAGGAATGCCGTAGAGCATTTGTCCTAGGTATTGACAGCAGCACGGTTGGCGTAGAACCACTTCTTTGCTCTCCCGAGGAGGGAGAACG[G/A]
AAACAGCCGCAGCCTGACGGCGTCGGGACTGATGCCCTTGATAGTGTACGTGCTATAAATCTCCAGGAACTGTTGCAGATGAGCATTGGCATCCTCATTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.80% | 18.20% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 48.30% | 51.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 65.30% | 34.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 29.60% | 70.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 33.60% | 66.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 56.20% | 43.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 21.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0119345769 | C -> T | LOC_Os01g34960.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.317; most accessible tissue: Minghui63 young leaf, score: 75.006 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0119345769 | 3.85E-06 | NA | mr1002 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119345769 | NA | 8.66E-10 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119345769 | NA | 2.36E-13 | mr1084 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119345769 | NA | 8.63E-14 | mr1205 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119345769 | NA | 2.30E-06 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119345769 | NA | 1.83E-13 | mr1521 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119345769 | NA | 8.12E-06 | mr1773 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119345769 | NA | 5.80E-12 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119345769 | NA | 3.34E-10 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119345769 | NA | 4.31E-08 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119345769 | NA | 8.64E-06 | mr1621_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119345769 | NA | 4.58E-07 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |