\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119284442:

Variant ID: vg0119284442 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 19284442
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


GATCATCTTTCATATTCTACTAGTGTGGATTGCATGGATACGGGACTACCACGGGTGGAACTACGTACACCTGGGATGGGAATAGCTAATTATATTGCCT[C/T]
GCTAGGGCTCAGTTTCTACTGTTTTTTTTAGGAAAAAATTGCTATAGGATACTCAAAAATCGTGTAATTGTCTAAGAGACACTGTAAAAATGTGACACTG

Reverse complement sequence

CAGTGTCACATTTTTACAGTGTCTCTTAGACAATTACACGATTTTTGAGTATCCTATAGCAATTTTTTCCTAAAAAAAACAGTAGAAACTGAGCCCTAGC[G/A]
AGGCAATATAATTAGCTATTCCCATCCCAGGTGTACGTAGTTCCACCCGTGGTAGTCCCGTATCCATGCAATCCACACTAGTAGAATATGAAAGATGATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.80% 22.10% 0.06% 0.00% NA
All Indica  2759 98.30% 1.70% 0.00% 0.00% NA
All Japonica  1512 41.70% 58.10% 0.20% 0.00% NA
Aus  269 79.90% 20.10% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 95.90% 4.10% 0.00% 0.00% NA
Temperate Japonica  767 64.40% 35.50% 0.13% 0.00% NA
Tropical Japonica  504 15.50% 84.50% 0.00% 0.00% NA
Japonica Intermediate  241 24.50% 74.70% 0.83% 0.00% NA
VI/Aromatic  96 55.20% 44.80% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0119284442 C -> T LOC_Os01g34890.1 upstream_gene_variant ; 3984.0bp to feature; MODIFIER silent_mutation Average:72.73; most accessible tissue: Callus, score: 85.496 N N N N
vg0119284442 C -> T LOC_Os01g34900.1 upstream_gene_variant ; 2176.0bp to feature; MODIFIER silent_mutation Average:72.73; most accessible tissue: Callus, score: 85.496 N N N N
vg0119284442 C -> T LOC_Os01g34910.1 downstream_gene_variant ; 519.0bp to feature; MODIFIER silent_mutation Average:72.73; most accessible tissue: Callus, score: 85.496 N N N N
vg0119284442 C -> T LOC_Os01g34900-LOC_Os01g34910 intergenic_region ; MODIFIER silent_mutation Average:72.73; most accessible tissue: Callus, score: 85.496 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0119284442 NA 2.03E-13 mr1002 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119284442 NA 2.11E-11 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119284442 NA 1.77E-11 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119284442 NA 1.24E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119284442 NA 2.60E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251