\
| Variant ID: vg0119284442 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 19284442 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 291. )
GATCATCTTTCATATTCTACTAGTGTGGATTGCATGGATACGGGACTACCACGGGTGGAACTACGTACACCTGGGATGGGAATAGCTAATTATATTGCCT[C/T]
GCTAGGGCTCAGTTTCTACTGTTTTTTTTAGGAAAAAATTGCTATAGGATACTCAAAAATCGTGTAATTGTCTAAGAGACACTGTAAAAATGTGACACTG
CAGTGTCACATTTTTACAGTGTCTCTTAGACAATTACACGATTTTTGAGTATCCTATAGCAATTTTTTCCTAAAAAAAACAGTAGAAACTGAGCCCTAGC[G/A]
AGGCAATATAATTAGCTATTCCCATCCCAGGTGTACGTAGTTCCACCCGTGGTAGTCCCGTATCCATGCAATCCACACTAGTAGAATATGAAAGATGATC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.80% | 22.10% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 41.70% | 58.10% | 0.20% | 0.00% | NA |
| Aus | 269 | 79.90% | 20.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 64.40% | 35.50% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 15.50% | 84.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 24.50% | 74.70% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 55.20% | 44.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 26.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0119284442 | C -> T | LOC_Os01g34890.1 | upstream_gene_variant ; 3984.0bp to feature; MODIFIER | silent_mutation | Average:72.73; most accessible tissue: Callus, score: 85.496 | N | N | N | N |
| vg0119284442 | C -> T | LOC_Os01g34900.1 | upstream_gene_variant ; 2176.0bp to feature; MODIFIER | silent_mutation | Average:72.73; most accessible tissue: Callus, score: 85.496 | N | N | N | N |
| vg0119284442 | C -> T | LOC_Os01g34910.1 | downstream_gene_variant ; 519.0bp to feature; MODIFIER | silent_mutation | Average:72.73; most accessible tissue: Callus, score: 85.496 | N | N | N | N |
| vg0119284442 | C -> T | LOC_Os01g34900-LOC_Os01g34910 | intergenic_region ; MODIFIER | silent_mutation | Average:72.73; most accessible tissue: Callus, score: 85.496 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0119284442 | NA | 2.03E-13 | mr1002 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119284442 | NA | 2.11E-11 | mr1084 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119284442 | NA | 1.77E-11 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119284442 | NA | 1.24E-08 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119284442 | NA | 2.60E-09 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |