\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119275798:

Variant ID: vg0119275798 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 19275798
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


CATCTAACTCGTGAATTAGGGTGAAAATGATTAATAAAAGAGTTAGTGTATGTTTAGTGCATATGCACGGTATTAGTCTAGCGGTCTGTGTAAGAAAAAA[T/A]
TTATAAAAGAATAGAAAAGAAAAACATACATCATTTTATTTGTCAAACAACTGGTGGGAATGTCTTATTTTGATAATGTTAAGCTTGTTTATGGGGATAA

Reverse complement sequence

TTATCCCCATAAACAAGCTTAACATTATCAAAATAAGACATTCCCACCAGTTGTTTGACAAATAAAATGATGTATGTTTTTCTTTTCTATTCTTTTATAA[A/T]
TTTTTTCTTACACAGACCGCTAGACTAATACCGTGCATATGCACTAAACATACACTAACTCTTTTATTAATCATTTTCACCCTAATTCACGAGTTAGATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.20% 22.70% 0.02% 0.00% NA
All Indica  2759 92.50% 7.50% 0.00% 0.00% NA
All Japonica  1512 60.80% 39.10% 0.07% 0.00% NA
Aus  269 26.80% 73.20% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 85.80% 14.20% 0.00% 0.00% NA
Indica Intermediate  786 92.40% 7.60% 0.00% 0.00% NA
Temperate Japonica  767 36.40% 63.50% 0.13% 0.00% NA
Tropical Japonica  504 89.90% 10.10% 0.00% 0.00% NA
Japonica Intermediate  241 78.00% 22.00% 0.00% 0.00% NA
VI/Aromatic  96 45.80% 54.20% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0119275798 T -> A LOC_Os01g34890.1 intron_variant ; MODIFIER silent_mutation Average:46.105; most accessible tissue: Callus, score: 71.562 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0119275798 NA 1.63E-10 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119275798 NA 1.09E-07 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119275798 NA 6.56E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119275798 NA 8.65E-06 mr1289 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119275798 NA 1.40E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119275798 NA 2.41E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119275798 NA 5.98E-10 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119275798 NA 4.60E-10 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119275798 NA 1.92E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119275798 NA 5.47E-07 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251