\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119116783:

Variant ID: vg0119116783 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 19116783
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 131. )

Flanking Sequence (100 bp) in Reference Genome:


ATAAGACGATGGGTCATACTGCTCTGACTCTGGAAATATGCGCTGCCGGCGGGCTTCCCATTCCTGAATGTACTCATGATGTGTCTCTTCCCAGTTCTCA[T/C]
GTTCTCTGCCACGTCGACTAATACGATGCAGCGCCTGTAGGGTAGGTCGAAAAGGTGGTGGAATGGATTGGCGAAGCCCAAATTGCCGCATCACTCGCTC

Reverse complement sequence

GAGCGAGTGATGCGGCAATTTGGGCTTCGCCAATCCATTCCACCACCTTTTCGACCTACCCTACAGGCGCTGCATCGTATTAGTCGACGTGGCAGAGAAC[A/G]
TGAGAACTGGGAAGAGACACATCATGAGTACATTCAGGAATGGGAAGCCCGCCGGCAGCGCATATTTCCAGAGTCAGAGCAGTATGACCCATCGTCTTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.90% 14.50% 1.61% 0.00% NA
All Indica  2759 99.50% 0.40% 0.07% 0.00% NA
All Japonica  1512 52.40% 43.10% 4.50% 0.00% NA
Aus  269 96.70% 2.20% 1.12% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.30% 1.50% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.50% 0.13% 0.00% NA
Temperate Japonica  767 25.20% 68.20% 6.65% 0.00% NA
Tropical Japonica  504 81.70% 15.90% 2.38% 0.00% NA
Japonica Intermediate  241 78.00% 19.90% 2.07% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 80.00% 16.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0119116783 T -> C LOC_Os01g34670.1 missense_variant ; p.His438Arg; MODERATE nonsynonymous_codon ; H438R Average:44.622; most accessible tissue: Minghui63 flag leaf, score: 54.348 possibly damaging -1.872 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0119116783 NA 3.08E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119116783 NA 3.55E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119116783 NA 3.25E-09 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119116783 NA 3.19E-10 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119116783 NA 1.60E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119116783 NA 1.65E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119116783 NA 2.43E-09 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119116783 NA 2.11E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119116783 NA 7.34E-09 mr1794 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119116783 NA 7.11E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119116783 NA 5.44E-11 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119116783 NA 7.10E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119116783 NA 7.59E-09 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119116783 NA 1.70E-08 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119116783 4.20E-06 4.20E-06 mr1548_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119116783 NA 1.86E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119116783 NA 9.69E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119116783 NA 5.84E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119116783 NA 2.90E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119116783 NA 2.45E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251