\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119055917:

Variant ID: vg0119055917 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 19055917
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, T: 0.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


TAATCTTATGCACCATATAAATATTATCAATCCAGATAATCGACACCTTGTGACTCAAAATTTCTACTATGCATTTACTACGGTGCATGTTAGAAAAAAC[T/A]
TTTTTTTTCTTTTTGCAAATTAATGTGGATTTATTTCAGGCAGGATTCAATATGTGTCCTAACCTACATTTTTTTCTTATTCTTGAATCCCATTCTTAAA

Reverse complement sequence

TTTAAGAATGGGATTCAAGAATAAGAAAAAAATGTAGGTTAGGACACATATTGAATCCTGCCTGAAATAAATCCACATTAATTTGCAAAAAGAAAAAAAA[A/T]
GTTTTTTCTAACATGCACCGTAGTAAATGCATAGTAGAAATTTTGAGTCACAAGGTGTCGATTATCTGGATTGATAATATTTATATGGTGCATAAGATTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.10% 37.30% 0.55% 0.00% NA
All Indica  2759 88.90% 10.50% 0.62% 0.00% NA
All Japonica  1512 20.60% 79.00% 0.46% 0.00% NA
Aus  269 48.30% 51.70% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 94.80% 5.20% 0.00% 0.00% NA
Indica III  913 80.00% 18.30% 1.75% 0.00% NA
Indica Intermediate  786 87.70% 12.20% 0.13% 0.00% NA
Temperate Japonica  767 5.20% 94.40% 0.39% 0.00% NA
Tropical Japonica  504 29.80% 69.80% 0.40% 0.00% NA
Japonica Intermediate  241 50.20% 49.00% 0.83% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 45.60% 52.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0119055917 T -> A LOC_Os01g34540.1 upstream_gene_variant ; 1752.0bp to feature; MODIFIER silent_mutation Average:40.395; most accessible tissue: Zhenshan97 young leaf, score: 59.009 N N N N
vg0119055917 T -> A LOC_Os01g34550.1 upstream_gene_variant ; 311.0bp to feature; MODIFIER silent_mutation Average:40.395; most accessible tissue: Zhenshan97 young leaf, score: 59.009 N N N N
vg0119055917 T -> A LOC_Os01g34560.1 upstream_gene_variant ; 3316.0bp to feature; MODIFIER silent_mutation Average:40.395; most accessible tissue: Zhenshan97 young leaf, score: 59.009 N N N N
vg0119055917 T -> A LOC_Os01g34540-LOC_Os01g34550 intergenic_region ; MODIFIER silent_mutation Average:40.395; most accessible tissue: Zhenshan97 young leaf, score: 59.009 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0119055917 NA 1.14E-18 mr1228 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251