\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118918206:

Variant ID: vg0118918206 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 18918206
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.66, G: 0.34, others allele: 0.00, population size: 35. )

Flanking Sequence (100 bp) in Reference Genome:


ATTACAATAGGAAATATTGCCAAAATTTGGAAGTCTATTGGTTTCCTCCGAGTGGGCCGGTCTGACCAGCGTGTGTTGGGCGGTCAGACCGCTGGTTGAG[A/G]
GCCGGTCAGACCGGCGGTGTGTGGCCGGTCTGATCGGCAGGTCCGAGTCCGACTGTGTTTCGTCGGGTCTCGAGGTTTCCTTACTCGGGAAGGCATGTTT

Reverse complement sequence

AAACATGCCTTCCCGAGTAAGGAAACCTCGAGACCCGACGAAACACAGTCGGACTCGGACCTGCCGATCAGACCGGCCACACACCGCCGGTCTGACCGGC[T/C]
CTCAACCAGCGGTCTGACCGCCCAACACACGCTGGTCAGACCGGCCCACTCGGAGGAAACCAATAGACTTCCAAATTTTGGCAATATTTCCTATTGTAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.70% 15.80% 22.39% 21.12% NA
All Indica  2759 7.40% 22.60% 35.30% 34.76% NA
All Japonica  1512 94.80% 3.10% 0.40% 1.72% NA
Aus  269 50.60% 27.10% 22.30% 0.00% NA
Indica I  595 1.30% 50.30% 31.76% 16.64% NA
Indica II  465 5.60% 8.60% 41.72% 44.09% NA
Indica III  913 9.60% 13.90% 34.83% 41.62% NA
Indica Intermediate  786 10.30% 20.00% 34.73% 34.99% NA
Temperate Japonica  767 99.20% 0.00% 0.26% 0.52% NA
Tropical Japonica  504 86.30% 9.30% 0.40% 3.97% NA
Japonica Intermediate  241 98.30% 0.00% 0.83% 0.83% NA
VI/Aromatic  96 97.90% 0.00% 2.08% 0.00% NA
Intermediate  90 64.40% 3.30% 17.78% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0118918206 A -> G LOC_Os01g34320.1 upstream_gene_variant ; 2614.0bp to feature; MODIFIER silent_mutation Average:52.17; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 N N N N
vg0118918206 A -> G LOC_Os01g34310.1 downstream_gene_variant ; 226.0bp to feature; MODIFIER silent_mutation Average:52.17; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 N N N N
vg0118918206 A -> G LOC_Os01g34310-LOC_Os01g34320 intergenic_region ; MODIFIER silent_mutation Average:52.17; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 N N N N
vg0118918206 A -> DEL N N silent_mutation Average:52.17; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0118918206 NA 9.22E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118918206 NA 1.48E-16 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118918206 NA 5.02E-21 mr1254 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118918206 NA 2.56E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118918206 1.96E-06 1.96E-06 mr1516 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118918206 NA 2.74E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118918206 NA 2.35E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118918206 NA 5.91E-06 mr1669 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118918206 NA 9.44E-06 mr1680 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118918206 NA 1.08E-06 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118918206 NA 2.98E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118918206 NA 1.57E-07 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118918206 NA 4.97E-11 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118918206 NA 4.97E-11 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251