Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118887296:

Variant ID: vg0118887296 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 18887296
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAATTTGATCAGTCTATGCTAGGTCTTAGTGTTGTGAAAAGAATTACAAAACTGGCTTTGCGCAAAGAACCATAGCCATCCTTTGAATACCCCTATCAT[G/A]
TGCATTGTTGCTGTGATGGCTTGCTGAGTACGGTTGGTACTCACCCTTACAGTATACAAACTTAATCAGAGGCCGGAGATGAAGCTTCGGAGGATCCCTA

Reverse complement sequence

TAGGGATCCTCCGAAGCTTCATCTCCGGCCTCTGATTAAGTTTGTATACTGTAAGGGTGAGTACCAACCGTACTCAGCAAGCCATCACAGCAACAATGCA[C/T]
ATGATAGGGGTATTCAAAGGATGGCTATGGTTCTTTGCGCAAAGCCAGTTTTGTAATTCTTTTCACAACACTAAGACCTAGCATAGACTGATCAAATTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.70%	15.10%	1.14%	0.00%	NA
All Indica	2759	96.00%	2.10%	1.85%	0.00%	NA
All Japonica	1512	64.10%	35.80%	0.07%	0.00%	NA
Aus	269	74.00%	26.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.20%	0.17%	0.00%	NA
Indica II	465	88.60%	2.40%	9.03%	0.00%	NA
Indica III	913	98.50%	1.50%	0.00%	0.00%	NA
Indica Intermediate	786	94.80%	4.20%	1.02%	0.00%	NA
Temperate Japonica	767	85.90%	14.10%	0.00%	0.00%	NA
Tropical Japonica	504	43.70%	56.20%	0.20%	0.00%	NA
Japonica Intermediate	241	37.30%	62.70%	0.00%	0.00%	NA
VI/Aromatic	96	72.90%	27.10%	0.00%	0.00%	NA
Intermediate	90	77.80%	20.00%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0118887296	G -> A	LOC_Os01g34250.1	downstream_gene_variant ; 3180.0bp to feature; MODIFIER	silent_mutation	Average:45.764; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg0118887296	G -> A	LOC_Os01g34260.1	downstream_gene_variant ; 856.0bp to feature; MODIFIER	silent_mutation	Average:45.764; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg0118887296	G -> A	LOC_Os01g34250-LOC_Os01g34260	intergenic_region ; MODIFIER	silent_mutation	Average:45.764; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0118887296	NA	3.26E-06	mr1138_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118887296	NA	3.46E-07	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118887296	NA	3.71E-06	mr1379_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118887296	NA	4.36E-07	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118887296	NA	1.09E-06	mr1406_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118887296	1.17E-06	1.17E-06	mr1406_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118887296	NA	2.12E-06	mr1509_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118887296	NA	3.61E-06	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118887296	NA	1.73E-09	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118887296	NA	3.71E-09	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118887296	NA	1.56E-06	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118887296	NA	3.82E-09	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118887296	NA	2.06E-07	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251