Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118878498:

Variant ID: vg0118878498 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 18878498
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, A: 0.25, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

AGCTCTATTCACCGAGCTGAGTTGGCGAGTACCGAGTTTGCTCACCACCCGTTTCGAGAGGAGAGCAACTCCGTCTGCACAGTCGAGGACACACCTTGCT[A/G]
CTACAACCCGATAGTGACTCGACTGTCCCGATGGGCTGAGGCAGTAGACGACTTCTACTAGGAGGCTCTGTTAGAGATCGACGACCAGCAGAGGCGTGTG

Reverse complement sequence

CACACGCCTCTGCTGGTCGTCGATCTCTAACAGAGCCTCCTAGTAGAAGTCGTCTACTGCCTCAGCCCATCGGGACAGTCGAGTCACTATCGGGTTGTAG[T/C]
AGCAAGGTGTGTCCTCGACTGTGCAGACGGAGTTGCTCTCCTCTCGAAACGGGTGGTGAGCAAACTCGGTACTCGCCAACTCAGCTCGGTGAATAGAGCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.60%	24.80%	3.22%	6.37%	NA
All Indica	2759	80.80%	4.50%	5.29%	9.42%	NA
All Japonica	1512	38.60%	58.50%	0.26%	2.58%	NA
Aus	269	76.20%	23.40%	0.37%	0.00%	NA
Indica I	595	61.80%	1.30%	12.94%	23.87%	NA
Indica II	465	84.30%	3.20%	1.72%	10.75%	NA
Indica III	913	89.80%	7.40%	2.08%	0.66%	NA
Indica Intermediate	786	82.40%	4.30%	5.34%	7.89%	NA
Temperate Japonica	767	15.00%	85.00%	0.00%	0.00%	NA
Tropical Japonica	504	61.90%	29.60%	0.79%	7.74%	NA
Japonica Intermediate	241	65.10%	34.90%	0.00%	0.00%	NA
VI/Aromatic	96	30.20%	69.80%	0.00%	0.00%	NA
Intermediate	90	58.90%	37.80%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0118878498	A -> G	LOC_Os01g34240.1	upstream_gene_variant ; 191.0bp to feature; MODIFIER	silent_mutation	Average:39.689; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg0118878498	A -> G	LOC_Os01g34250.1	upstream_gene_variant ; 1206.0bp to feature; MODIFIER	silent_mutation	Average:39.689; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg0118878498	A -> G	LOC_Os01g34230.1	downstream_gene_variant ; 2162.0bp to feature; MODIFIER	silent_mutation	Average:39.689; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg0118878498	A -> G	LOC_Os01g34230-LOC_Os01g34240	intergenic_region ; MODIFIER	silent_mutation	Average:39.689; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg0118878498	A -> DEL	N	N	silent_mutation	Average:39.689; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0118878498	6.06E-06	6.05E-06	mr1621	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118878498	NA	4.80E-06	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118878498	NA	4.39E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118878498	1.89E-06	NA	mr1818_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251