\
| Variant ID: vg0118878498 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 18878498 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, A: 0.25, others allele: 0.00, population size: 72. )
AGCTCTATTCACCGAGCTGAGTTGGCGAGTACCGAGTTTGCTCACCACCCGTTTCGAGAGGAGAGCAACTCCGTCTGCACAGTCGAGGACACACCTTGCT[A/G]
CTACAACCCGATAGTGACTCGACTGTCCCGATGGGCTGAGGCAGTAGACGACTTCTACTAGGAGGCTCTGTTAGAGATCGACGACCAGCAGAGGCGTGTG
CACACGCCTCTGCTGGTCGTCGATCTCTAACAGAGCCTCCTAGTAGAAGTCGTCTACTGCCTCAGCCCATCGGGACAGTCGAGTCACTATCGGGTTGTAG[T/C]
AGCAAGGTGTGTCCTCGACTGTGCAGACGGAGTTGCTCTCCTCTCGAAACGGGTGGTGAGCAAACTCGGTACTCGCCAACTCAGCTCGGTGAATAGAGCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.60% | 24.80% | 3.22% | 6.37% | NA |
| All Indica | 2759 | 80.80% | 4.50% | 5.29% | 9.42% | NA |
| All Japonica | 1512 | 38.60% | 58.50% | 0.26% | 2.58% | NA |
| Aus | 269 | 76.20% | 23.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 61.80% | 1.30% | 12.94% | 23.87% | NA |
| Indica II | 465 | 84.30% | 3.20% | 1.72% | 10.75% | NA |
| Indica III | 913 | 89.80% | 7.40% | 2.08% | 0.66% | NA |
| Indica Intermediate | 786 | 82.40% | 4.30% | 5.34% | 7.89% | NA |
| Temperate Japonica | 767 | 15.00% | 85.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 61.90% | 29.60% | 0.79% | 7.74% | NA |
| Japonica Intermediate | 241 | 65.10% | 34.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 30.20% | 69.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 37.80% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0118878498 | A -> G | LOC_Os01g34240.1 | upstream_gene_variant ; 191.0bp to feature; MODIFIER | silent_mutation | Average:39.689; most accessible tissue: Minghui63 flag leaf, score: 73.334 | N | N | N | N |
| vg0118878498 | A -> G | LOC_Os01g34250.1 | upstream_gene_variant ; 1206.0bp to feature; MODIFIER | silent_mutation | Average:39.689; most accessible tissue: Minghui63 flag leaf, score: 73.334 | N | N | N | N |
| vg0118878498 | A -> G | LOC_Os01g34230.1 | downstream_gene_variant ; 2162.0bp to feature; MODIFIER | silent_mutation | Average:39.689; most accessible tissue: Minghui63 flag leaf, score: 73.334 | N | N | N | N |
| vg0118878498 | A -> G | LOC_Os01g34230-LOC_Os01g34240 | intergenic_region ; MODIFIER | silent_mutation | Average:39.689; most accessible tissue: Minghui63 flag leaf, score: 73.334 | N | N | N | N |
| vg0118878498 | A -> DEL | N | N | silent_mutation | Average:39.689; most accessible tissue: Minghui63 flag leaf, score: 73.334 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0118878498 | 6.06E-06 | 6.05E-06 | mr1621 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118878498 | NA | 4.80E-06 | mr1844 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118878498 | NA | 4.39E-08 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118878498 | 1.89E-06 | NA | mr1818_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |