\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118878498:

Variant ID: vg0118878498 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 18878498
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, A: 0.25, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


AGCTCTATTCACCGAGCTGAGTTGGCGAGTACCGAGTTTGCTCACCACCCGTTTCGAGAGGAGAGCAACTCCGTCTGCACAGTCGAGGACACACCTTGCT[A/G]
CTACAACCCGATAGTGACTCGACTGTCCCGATGGGCTGAGGCAGTAGACGACTTCTACTAGGAGGCTCTGTTAGAGATCGACGACCAGCAGAGGCGTGTG

Reverse complement sequence

CACACGCCTCTGCTGGTCGTCGATCTCTAACAGAGCCTCCTAGTAGAAGTCGTCTACTGCCTCAGCCCATCGGGACAGTCGAGTCACTATCGGGTTGTAG[T/C]
AGCAAGGTGTGTCCTCGACTGTGCAGACGGAGTTGCTCTCCTCTCGAAACGGGTGGTGAGCAAACTCGGTACTCGCCAACTCAGCTCGGTGAATAGAGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 24.80% 3.22% 6.37% NA
All Indica  2759 80.80% 4.50% 5.29% 9.42% NA
All Japonica  1512 38.60% 58.50% 0.26% 2.58% NA
Aus  269 76.20% 23.40% 0.37% 0.00% NA
Indica I  595 61.80% 1.30% 12.94% 23.87% NA
Indica II  465 84.30% 3.20% 1.72% 10.75% NA
Indica III  913 89.80% 7.40% 2.08% 0.66% NA
Indica Intermediate  786 82.40% 4.30% 5.34% 7.89% NA
Temperate Japonica  767 15.00% 85.00% 0.00% 0.00% NA
Tropical Japonica  504 61.90% 29.60% 0.79% 7.74% NA
Japonica Intermediate  241 65.10% 34.90% 0.00% 0.00% NA
VI/Aromatic  96 30.20% 69.80% 0.00% 0.00% NA
Intermediate  90 58.90% 37.80% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0118878498 A -> G LOC_Os01g34240.1 upstream_gene_variant ; 191.0bp to feature; MODIFIER silent_mutation Average:39.689; most accessible tissue: Minghui63 flag leaf, score: 73.334 N N N N
vg0118878498 A -> G LOC_Os01g34250.1 upstream_gene_variant ; 1206.0bp to feature; MODIFIER silent_mutation Average:39.689; most accessible tissue: Minghui63 flag leaf, score: 73.334 N N N N
vg0118878498 A -> G LOC_Os01g34230.1 downstream_gene_variant ; 2162.0bp to feature; MODIFIER silent_mutation Average:39.689; most accessible tissue: Minghui63 flag leaf, score: 73.334 N N N N
vg0118878498 A -> G LOC_Os01g34230-LOC_Os01g34240 intergenic_region ; MODIFIER silent_mutation Average:39.689; most accessible tissue: Minghui63 flag leaf, score: 73.334 N N N N
vg0118878498 A -> DEL N N silent_mutation Average:39.689; most accessible tissue: Minghui63 flag leaf, score: 73.334 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0118878498 6.06E-06 6.05E-06 mr1621 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118878498 NA 4.80E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118878498 NA 4.39E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118878498 1.89E-06 NA mr1818_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251