Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118830337:

Variant ID: vg0118830337 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 18830337
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.26, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

AGATATAGGAGACACCTCTTCTCCCTTCCTGATCACCTCAACGCCTCATTTAGTGTAGCGTCCTTGGAGAAGAAAGAACCCCACTACCACCATCCTTGCA[G/A]
TCGCATGGCTTGCTGATGGGTCGAATGAGAGGAGCAGAGGTAGGGCGCCAGTTCCTACATTGGGACCACCAGATCATTCATCCTTGACTCTGCTGCTCCA

Reverse complement sequence

TGGAGCAGCAGAGTCAAGGATGAATGATCTGGTGGTCCCAATGTAGGAACTGGCGCCCTACCTCTGCTCCTCTCATTCGACCCATCAGCAAGCCATGCGA[C/T]
TGCAAGGATGGTGGTAGTGGGGTTCTTTCTTCTCCAAGGACGCTACACTAAATGAGGCGTTGAGGTGATCAGGAAGGGAGAAGAGGTGTCTCCTATATCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.90%	49.80%	0.06%	0.28%	NA
All Indica	2759	21.00%	78.60%	0.07%	0.29%	NA
All Japonica	1512	97.80%	2.20%	0.00%	0.07%	NA
Aus	269	52.40%	47.60%	0.00%	0.00%	NA
Indica I	595	2.90%	96.80%	0.17%	0.17%	NA
Indica II	465	40.90%	58.70%	0.22%	0.22%	NA
Indica III	913	19.50%	80.40%	0.00%	0.11%	NA
Indica Intermediate	786	24.80%	74.60%	0.00%	0.64%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	95.20%	4.80%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.20%	0.00%	0.41%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	71.10%	23.30%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0118830337	G -> A	LOC_Os01g34140-LOC_Os01g34180	intergenic_region ; MODIFIER	silent_mutation	Average:73.772; most accessible tissue: Zhenshan97 young leaf, score: 86.698	N	N	N	N
vg0118830337	G -> DEL	N	N	silent_mutation	Average:73.772; most accessible tissue: Zhenshan97 young leaf, score: 86.698	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0118830337	NA	8.00E-08	Grain_thickness	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0118830337	NA	5.08E-11	Grain_width	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0118830337	NA	4.91E-27	mr1130	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337	NA	7.94E-06	mr1169	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337	NA	7.36E-07	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337	NA	1.06E-15	mr1228	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337	NA	2.38E-22	mr1254	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337	NA	1.96E-08	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337	NA	4.55E-09	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337	NA	1.13E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337	NA	6.55E-13	mr1924	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337	NA	2.91E-07	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337	NA	2.51E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337	NA	8.25E-09	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337	NA	2.49E-07	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337	NA	1.44E-13	mr1717_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337	NA	1.58E-12	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337	NA	2.01E-10	mr1893_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337	NA	7.95E-12	mr1946_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337	NA	7.95E-12	mr1948_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251