\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118830337:

Variant ID: vg0118830337 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 18830337
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.26, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


AGATATAGGAGACACCTCTTCTCCCTTCCTGATCACCTCAACGCCTCATTTAGTGTAGCGTCCTTGGAGAAGAAAGAACCCCACTACCACCATCCTTGCA[G/A]
TCGCATGGCTTGCTGATGGGTCGAATGAGAGGAGCAGAGGTAGGGCGCCAGTTCCTACATTGGGACCACCAGATCATTCATCCTTGACTCTGCTGCTCCA

Reverse complement sequence

TGGAGCAGCAGAGTCAAGGATGAATGATCTGGTGGTCCCAATGTAGGAACTGGCGCCCTACCTCTGCTCCTCTCATTCGACCCATCAGCAAGCCATGCGA[C/T]
TGCAAGGATGGTGGTAGTGGGGTTCTTTCTTCTCCAAGGACGCTACACTAAATGAGGCGTTGAGGTGATCAGGAAGGGAGAAGAGGTGTCTCCTATATCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.90% 49.80% 0.06% 0.28% NA
All Indica  2759 21.00% 78.60% 0.07% 0.29% NA
All Japonica  1512 97.80% 2.20% 0.00% 0.07% NA
Aus  269 52.40% 47.60% 0.00% 0.00% NA
Indica I  595 2.90% 96.80% 0.17% 0.17% NA
Indica II  465 40.90% 58.70% 0.22% 0.22% NA
Indica III  913 19.50% 80.40% 0.00% 0.11% NA
Indica Intermediate  786 24.80% 74.60% 0.00% 0.64% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 95.20% 4.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.20% 0.00% 0.41% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 71.10% 23.30% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0118830337 G -> A LOC_Os01g34140-LOC_Os01g34180 intergenic_region ; MODIFIER silent_mutation Average:73.772; most accessible tissue: Zhenshan97 young leaf, score: 86.698 N N N N
vg0118830337 G -> DEL N N silent_mutation Average:73.772; most accessible tissue: Zhenshan97 young leaf, score: 86.698 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0118830337 NA 8.00E-08 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0118830337 NA 5.08E-11 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0118830337 NA 4.91E-27 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337 NA 7.94E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337 NA 7.36E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337 NA 1.06E-15 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337 NA 2.38E-22 mr1254 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337 NA 1.96E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337 NA 4.55E-09 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337 NA 1.13E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337 NA 6.55E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337 NA 2.91E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337 NA 2.51E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337 NA 8.25E-09 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337 NA 2.49E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337 NA 1.44E-13 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337 NA 1.58E-12 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337 NA 2.01E-10 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337 NA 7.95E-12 mr1946_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118830337 NA 7.95E-12 mr1948_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251