Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118822385:

Variant ID: vg0118822385 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 18822385
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


AGGCGGTGCTCCCAACAAATTGTGCATTAGACTTGTCTCGTGGAGTCTAATTAAGGGTCATTTGGCTACTCCAATCTTTGGGAGGCCATATATGAGCCTT[T/G]
GAGGTTTAGTTCACTTCCAAGTCAGCTTCATATTTATTAATTAATTGGACTGCAAGTGGTTGTTATCAATTGTGCACTGCAACAAAGACCAAAATACATA

Reverse complement sequence

TATGTATTTTGGTCTTTGTTGCAGTGCACAATTGATAACAACCACTTGCAGTCCAATTAATTAATAAATATGAAGCTGACTTGGAAGTGAACTAAACCTC[A/C]
AAGGCTCATATATGGCCTCCCAAAGATTGGAGTAGCCAAATGACCCTTAATTAGACTCCACGAGACAAGTCTAATGCACAATTTGTTGGGAGCACCGCCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.20% 11.80% 0.02% 0.00% NA
All Indica  2759 98.00% 2.00% 0.04% 0.00% NA
All Japonica  1512 71.90% 28.10% 0.00% 0.00% NA
Aus  269 79.60% 20.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 98.50% 1.50% 0.00% 0.00% NA
Indica Intermediate  786 95.70% 4.20% 0.13% 0.00% NA
Temperate Japonica  767 87.70% 12.30% 0.00% 0.00% NA
Tropical Japonica  504 51.20% 48.80% 0.00% 0.00% NA
Japonica Intermediate  241 64.70% 35.30% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0118822385 T -> G LOC_Os01g34140-LOC_Os01g34180 intergenic_region ; MODIFIER silent_mutation Average:81.244; most accessible tissue: Zhenshan97 root, score: 94.61 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0118822385 T G 0.07 0.09 0.04 0.0 0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0118822385 NA 2.33E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118822385 1.10E-06 1.10E-06 mr1317_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118822385 NA 3.85E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118822385 NA 2.11E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118822385 NA 2.50E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118822385 NA 1.90E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118822385 NA 3.69E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118822385 NA 8.08E-07 mr1818_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118822385 NA 2.35E-06 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118822385 NA 3.60E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251