RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0118782155:

Variant ID: vg0118782155 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 18782155
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCAGCTCGTCTTCGTCTGAGTCCATCTCGGGGCGATCTGCTGTCGAGATTGGGTGGCGGCCGGCAGGTGGGGGAAGCGGGAGGAGGGGATGGATGAGAGC[A/G]
TTGCGCCGCCGTGAGATGACAAGAGAGGTGAAGCGCGGAAGAGTGGTGGAGTGGTTCATGGGTCCCCCTCATCCTTCCGCTCCTCTGGCGAGTCCCTCCG

Reverse complement sequence

CGGAGGGACTCGCCAGAGGAGCGGAAGGATGAGGGGGACCCATGAACCACTCCACCACTCTTCCGCGCTTCACCTCTCTTGTCATCTCACGGCGGCGCAA[T/C]
GCTCTCATCCATCCCCTCCTCCCGCTTCCCCCACCTGCCGGCCGCCACCCAATCTCGACAGCAGATCGCCCCGAGATGGACTCAGACGAAGACGAGCTGC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.20%	12.20%	1.29%	39.27%	NA
All Indica	2759	32.10%	1.90%	2.10%	63.90%	NA
All Japonica	1512	67.20%	28.00%	0.20%	4.63%	NA
Aus	269	75.80%	23.40%	0.00%	0.74%	NA
Indica I	595	45.00%	0.50%	0.00%	54.45%	NA
Indica II	465	36.60%	1.50%	9.68%	52.26%	NA
Indica III	913	18.00%	1.90%	0.33%	79.85%	NA
Indica Intermediate	786	36.00%	3.30%	1.27%	59.41%	NA
Temperate Japonica	767	84.60%	15.30%	0.00%	0.13%	NA
Tropical Japonica	504	52.80%	33.90%	0.20%	13.10%	NA
Japonica Intermediate	241	41.90%	56.00%	0.83%	1.24%	NA
VI/Aromatic	96	72.90%	26.00%	0.00%	1.04%	NA
Intermediate	90	62.20%	15.60%	0.00%	22.22%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0118782155	A -> G	LOC_Os01g34090.1	upstream_gene_variant ; 3968.0bp to feature; MODIFIER	silent_mutation	Average:40.498; most accessible tissue: Zhenshan97 flag leaf, score: 84.998	N	N	N	N
vg0118782155	A -> G	LOC_Os01g34110.1	upstream_gene_variant ; 115.0bp to feature; MODIFIER	silent_mutation	Average:40.498; most accessible tissue: Zhenshan97 flag leaf, score: 84.998	N	N	N	N
vg0118782155	A -> G	LOC_Os01g34100.1	downstream_gene_variant ; 763.0bp to feature; MODIFIER	silent_mutation	Average:40.498; most accessible tissue: Zhenshan97 flag leaf, score: 84.998	N	N	N	N
vg0118782155	A -> G	LOC_Os01g34100-LOC_Os01g34110	intergenic_region ; MODIFIER	silent_mutation	Average:40.498; most accessible tissue: Zhenshan97 flag leaf, score: 84.998	N	N	N	N
vg0118782155	A -> DEL	N	N	silent_mutation	Average:40.498; most accessible tissue: Zhenshan97 flag leaf, score: 84.998	N	N	N	N

Showing 1 to 5 of 5 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0118782155	2.95E-06	NA	mr1035	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118782155	NA	5.86E-07	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 2 of 2 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0118782155:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact