\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118776462:

Variant ID: vg0118776462 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 18776462
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTAAGCGTGAAAAAAATATCAAACAAATAAAACAAAAATAAAAAATTTCGGGGGGGGGGGGGGGAGGGGCGCCAGCCACTCTGGCGCACTCCCCTTAGC[C/T]
ACCTCAGCATCGCCCCGCCACGTCGGTAGGGGGACGGCGCCAAAGAGGCTGGCGCCGTCCTGTTGAACGACGGCGCCAGCCACTCTAGCACCCCAAAAAG

Reverse complement sequence

CTTTTTGGGGTGCTAGAGTGGCTGGCGCCGTCGTTCAACAGGACGGCGCCAGCCTCTTTGGCGCCGTCCCCCTACCGACGTGGCGGGGCGATGCTGAGGT[G/A]
GCTAAGGGGAGTGCGCCAGAGTGGCTGGCGCCCCTCCCCCCCCCCCCCCCGAAATTTTTTATTTTTGTTTTATTTGTTTGATATTTTTTTCACGCTTAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.90% 2.20% 10.62% 2.26% NA
All Indica  2759 94.40% 0.40% 2.32% 2.90% NA
All Japonica  1512 70.60% 4.40% 23.81% 1.19% NA
Aus  269 76.20% 7.40% 14.50% 1.86% NA
Indica I  595 98.00% 0.00% 1.34% 0.67% NA
Indica II  465 88.00% 0.40% 3.01% 8.60% NA
Indica III  913 95.90% 0.50% 1.75% 1.75% NA
Indica Intermediate  786 93.60% 0.50% 3.31% 2.54% NA
Temperate Japonica  767 83.20% 1.00% 14.73% 1.04% NA
Tropical Japonica  504 64.50% 8.70% 25.79% 0.99% NA
Japonica Intermediate  241 43.20% 6.20% 48.55% 2.07% NA
VI/Aromatic  96 63.50% 5.20% 28.12% 3.12% NA
Intermediate  90 85.60% 0.00% 13.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0118776462 C -> T LOC_Os01g34100.1 upstream_gene_variant ; 4138.0bp to feature; MODIFIER silent_mutation Average:39.471; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0118776462 C -> T LOC_Os01g34080.1 downstream_gene_variant ; 1986.0bp to feature; MODIFIER silent_mutation Average:39.471; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0118776462 C -> T LOC_Os01g34090.1 downstream_gene_variant ; 1390.0bp to feature; MODIFIER silent_mutation Average:39.471; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0118776462 C -> T LOC_Os01g34080-LOC_Os01g34090 intergenic_region ; MODIFIER silent_mutation Average:39.471; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0118776462 C -> DEL N N silent_mutation Average:39.471; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0118776462 4.92E-06 NA mr1035 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118776462 NA 8.70E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118776462 NA 8.64E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251