\
| Variant ID: vg0118776462 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 18776462 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCTAAGCGTGAAAAAAATATCAAACAAATAAAACAAAAATAAAAAATTTCGGGGGGGGGGGGGGGAGGGGCGCCAGCCACTCTGGCGCACTCCCCTTAGC[C/T]
ACCTCAGCATCGCCCCGCCACGTCGGTAGGGGGACGGCGCCAAAGAGGCTGGCGCCGTCCTGTTGAACGACGGCGCCAGCCACTCTAGCACCCCAAAAAG
CTTTTTGGGGTGCTAGAGTGGCTGGCGCCGTCGTTCAACAGGACGGCGCCAGCCTCTTTGGCGCCGTCCCCCTACCGACGTGGCGGGGCGATGCTGAGGT[G/A]
GCTAAGGGGAGTGCGCCAGAGTGGCTGGCGCCCCTCCCCCCCCCCCCCCCGAAATTTTTTATTTTTGTTTTATTTGTTTGATATTTTTTTCACGCTTAGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.90% | 2.20% | 10.62% | 2.26% | NA |
| All Indica | 2759 | 94.40% | 0.40% | 2.32% | 2.90% | NA |
| All Japonica | 1512 | 70.60% | 4.40% | 23.81% | 1.19% | NA |
| Aus | 269 | 76.20% | 7.40% | 14.50% | 1.86% | NA |
| Indica I | 595 | 98.00% | 0.00% | 1.34% | 0.67% | NA |
| Indica II | 465 | 88.00% | 0.40% | 3.01% | 8.60% | NA |
| Indica III | 913 | 95.90% | 0.50% | 1.75% | 1.75% | NA |
| Indica Intermediate | 786 | 93.60% | 0.50% | 3.31% | 2.54% | NA |
| Temperate Japonica | 767 | 83.20% | 1.00% | 14.73% | 1.04% | NA |
| Tropical Japonica | 504 | 64.50% | 8.70% | 25.79% | 0.99% | NA |
| Japonica Intermediate | 241 | 43.20% | 6.20% | 48.55% | 2.07% | NA |
| VI/Aromatic | 96 | 63.50% | 5.20% | 28.12% | 3.12% | NA |
| Intermediate | 90 | 85.60% | 0.00% | 13.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0118776462 | C -> T | LOC_Os01g34100.1 | upstream_gene_variant ; 4138.0bp to feature; MODIFIER | silent_mutation | Average:39.471; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0118776462 | C -> T | LOC_Os01g34080.1 | downstream_gene_variant ; 1986.0bp to feature; MODIFIER | silent_mutation | Average:39.471; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0118776462 | C -> T | LOC_Os01g34090.1 | downstream_gene_variant ; 1390.0bp to feature; MODIFIER | silent_mutation | Average:39.471; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0118776462 | C -> T | LOC_Os01g34080-LOC_Os01g34090 | intergenic_region ; MODIFIER | silent_mutation | Average:39.471; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0118776462 | C -> DEL | N | N | silent_mutation | Average:39.471; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0118776462 | 4.92E-06 | NA | mr1035 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118776462 | NA | 8.70E-06 | mr1332 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118776462 | NA | 8.64E-07 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |