\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118775740:

Variant ID: vg0118775740 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 18775740
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTTCACTAAAATTAGACCATAACTCCTTTAGTAAAACCCTTTGATCAGCATGTTAAACATAATGCACTCTACCACTATATGAAATTACTTAATCTAATT[C/T]
AAAATATAACCACATGAAATGACATATATATAAGTTAAATAGTACATAGAGATGCAATTTTTTATTTTTATTTCATTTTTTTTGATATTTTTTTCGCACT

Reverse complement sequence

AGTGCGAAAAAAATATCAAAAAAAATGAAATAAAAATAAAAAATTGCATCTCTATGTACTATTTAACTTATATATATGTCATTTCATGTGGTTATATTTT[G/A]
AATTAGATTAAGTAATTTCATATAGTGGTAGAGTGCATTATGTTTAACATGCTGATCAAAGGGTTTTACTAAAGGAGTTATGGTCTAATTTTAGTGAAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.30% 0.20% 8.51% 14.03% NA
All Indica  2759 62.20% 0.30% 14.17% 23.27% NA
All Japonica  1512 99.10% 0.00% 0.20% 0.73% NA
Aus  269 97.00% 0.40% 1.12% 1.49% NA
Indica I  595 64.40% 0.00% 5.71% 29.92% NA
Indica II  465 45.40% 0.20% 29.46% 24.95% NA
Indica III  913 71.90% 0.30% 10.41% 17.42% NA
Indica Intermediate  786 59.40% 0.60% 15.90% 24.05% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 97.80% 0.00% 0.60% 1.59% NA
Japonica Intermediate  241 99.20% 0.00% 0.00% 0.83% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 0.00% 5.56% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0118775740 C -> T LOC_Os01g34100.1 upstream_gene_variant ; 4860.0bp to feature; MODIFIER silent_mutation Average:20.077; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 N N N N
vg0118775740 C -> T LOC_Os01g34080.1 downstream_gene_variant ; 1264.0bp to feature; MODIFIER silent_mutation Average:20.077; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 N N N N
vg0118775740 C -> T LOC_Os01g34090.1 downstream_gene_variant ; 2112.0bp to feature; MODIFIER silent_mutation Average:20.077; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 N N N N
vg0118775740 C -> T LOC_Os01g34080-LOC_Os01g34090 intergenic_region ; MODIFIER silent_mutation Average:20.077; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 N N N N
vg0118775740 C -> DEL N N silent_mutation Average:20.077; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0118775740 2.19E-06 NA mr1734_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118775740 6.60E-06 6.58E-06 mr1755_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118775740 4.08E-07 NA mr1782_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118775740 3.27E-06 NA mr1893_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251