\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118710442:

Variant ID: vg0118710442 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 18710442
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, A: 0.10, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


CGTATTTTCGCCCCATAAATCTAAAATTATGGGATTGGGAATAGGATAGGATATCTGTTGGGCATCCTCTTACTTTATCATTCCTCACCTGCAAATCAGG[T/A]
CATGAATTTTTCAGACTTTCATGTCCACATTCTTCCTTATAATTTTTAAGTATCTTCTCTGCACGTAATTACATGTTGCATGCCCATTTTGCCAAGATAA

Reverse complement sequence

TTATCTTGGCAAAATGGGCATGCAACATGTAATTACGTGCAGAGAAGATACTTAAAAATTATAAGGAAGAATGTGGACATGAAAGTCTGAAAAATTCATG[A/T]
CCTGATTTGCAGGTGAGGAATGATAAAGTAAGAGGATGCCCAACAGATATCCTATCCTATTCCCAATCCCATAATTTTAGATTTATGGGGCGAAAATACG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.40% 41.60% 0.00% 0.00% NA
All Indica  2759 92.00% 8.00% 0.00% 0.00% NA
All Japonica  1512 2.10% 97.90% 0.00% 0.00% NA
Aus  269 55.40% 44.60% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 85.20% 14.80% 0.00% 0.00% NA
Indica III  913 91.50% 8.50% 0.00% 0.00% NA
Indica Intermediate  786 91.30% 8.70% 0.00% 0.00% NA
Temperate Japonica  767 0.00% 100.00% 0.00% 0.00% NA
Tropical Japonica  504 5.20% 94.80% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 41.10% 58.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0118710442 T -> A LOC_Os01g34000.1 upstream_gene_variant ; 339.0bp to feature; MODIFIER silent_mutation Average:55.257; most accessible tissue: Callus, score: 86.091 N N N N
vg0118710442 T -> A LOC_Os01g33990.1 downstream_gene_variant ; 3980.0bp to feature; MODIFIER silent_mutation Average:55.257; most accessible tissue: Callus, score: 86.091 N N N N
vg0118710442 T -> A LOC_Os01g33990-LOC_Os01g34000 intergenic_region ; MODIFIER silent_mutation Average:55.257; most accessible tissue: Callus, score: 86.091 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0118710442 NA 3.53E-50 mr1154 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118710442 NA 3.32E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118710442 NA 2.53E-35 mr1081_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118710442 NA 2.86E-12 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118710442 NA 1.23E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118710442 NA 7.56E-36 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118710442 NA 1.18E-12 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251