Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0118689086:

Variant ID: vg0118689086 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 18689086
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATAAGTGATAGGTTTTGGGTAAGCTCGCTCATATCGAAAGAAGAATTCAAAGGAAATGAAGCATAAGCTGTCACCACTAGGAGTAGGACTTGGATGTTC[C/T]
GGAATCCTCTTGCCGAGCTGGAACGACCCATCTCCTATTTCAGCTTCCAACGCCTACACGTTGAGTCTGAGTTACTCGAGAAAGACTTATTCATAGTGGA

Reverse complement sequence

TCCACTATGAATAAGTCTTTCTCGAGTAACTCAGACTCAACGTGTAGGCGTTGGAAGCTGAAATAGGAGATGGGTCGTTCCAGCTCGGCAAGAGGATTCC[G/A]
GAACATCCAAGTCCTACTCCTAGTGGTGACAGCTTATGCTTCATTTCCTTTGAATTCTTCTTTCGATATGAGCGAGCTTACCCAAAACCTATCACTTATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.00% 6.50% 0.30% 4.15% NA
All Indica  2759 95.90% 1.30% 0.33% 2.39% NA
All Japonica  1512 77.60% 13.80% 0.26% 8.40% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 89.00% 1.30% 0.65% 9.03% NA
Indica III  913 96.10% 2.40% 0.00% 1.53% NA
Indica Intermediate  786 96.80% 1.10% 0.76% 1.27% NA
Temperate Japonica  767 98.30% 0.40% 0.26% 1.04% NA
Tropical Japonica  504 50.80% 37.10% 0.40% 11.71% NA
Japonica Intermediate  241 67.60% 7.50% 0.00% 24.90% NA
VI/Aromatic  96 42.70% 57.30% 0.00% 0.00% NA
Intermediate  90 87.80% 7.80% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0118689086 C -> T LOC_Os01g33960.1 intron_variant ; MODIFIER silent_mutation Average:84.968; most accessible tissue: Minghui63 flag leaf, score: 99.978 N N N N
vg0118689086 C -> DEL N N silent_mutation Average:84.968; most accessible tissue: Minghui63 flag leaf, score: 99.978 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0118689086 C T -0.11 -0.07 -0.11 -0.12 -0.12 -0.12

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0118689086 4.90E-06 NA mr1136 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118689086 5.26E-06 9.82E-07 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118689086 NA 1.66E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118689086 4.30E-06 3.17E-10 mr1830 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118689086 NA 4.60E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118689086 NA 1.93E-06 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251