Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118684354:

Variant ID: vg0118684354 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 18684354
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCAACCCAACTTGCTCTGGCCCTTGGTCCTCCCGCATCTCTTCCTCGGTAAGCGGACCGTGGAAGCTGGGGGGTATCCGCTTGGGACTGATAGAGAACA[G/A,T]
CATATCTTTTTTGTCCCTCCTGACCCCTAAAAAAAATATAGTTGAAGTCCGGTCGACGTTGTTATCCTTATATATTCTGTCAAAGAAAGTCCCTCGCGTA

Reverse complement sequence

TACGCGAGGGACTTTCTTTGACAGAATATATAAGGATAACAACGTCGACCGGACTTCAACTATATTTTTTTTAGGGGTCAGGAGGGACAAAAAAGATATG[C/T,A]
TGTTCTCTATCAGTCCCAAGCGGATACCCCCCAGCTTCCACGGTCCGCTTACCGAGGAAGAGATGCGGGAGGACCAAGGGCCAGAGCAAGTTGGGTTGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.70% 5.70% 0.70% 3.87% T: 0.02%
All Indica  2759 96.60% 1.00% 0.04% 2.32% T: 0.04%
All Japonica  1512 79.80% 10.60% 1.85% 7.80% NA
Aus  269 79.90% 19.30% 0.74% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 90.10% 0.90% 0.00% 8.82% T: 0.22%
Indica III  913 97.90% 0.80% 0.00% 1.31% NA
Indica Intermediate  786 96.40% 2.00% 0.13% 1.40% NA
Temperate Japonica  767 91.90% 5.00% 2.22% 0.91% NA
Tropical Japonica  504 69.00% 19.60% 0.20% 11.11% NA
Japonica Intermediate  241 63.50% 9.50% 4.15% 22.82% NA
VI/Aromatic  96 74.00% 25.00% 1.04% 0.00% NA
Intermediate  90 92.20% 5.60% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0118684354 G -> T LOC_Os01g33960.1 missense_variant ; p.Leu602Met; MODERATE nonsynonymous_codon ; L602M Average:55.467; most accessible tissue: Minghui63 flower, score: 99.987 unknown unknown TOLERATED 0.29
vg0118684354 G -> A LOC_Os01g33960.1 synonymous_variant ; p.Leu602Leu; LOW synonymous_codon Average:55.467; most accessible tissue: Minghui63 flower, score: 99.987 N N N N
vg0118684354 G -> DEL LOC_Os01g33960.1 N frameshift_variant Average:55.467; most accessible tissue: Minghui63 flower, score: 99.987 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0118684354 G A -0.03 -0.02 -0.01 -0.03 -0.01 -0.03
vg0118684354 G T -0.06 -0.04 -0.03 -0.06 -0.03 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0118684354 NA 6.45E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118684354 NA 9.34E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118684354 4.78E-07 9.89E-11 mr1260 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118684354 5.30E-06 8.34E-14 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118684354 1.72E-06 NA mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251