\
| Variant ID: vg0118565792 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 18565792 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 72. )
AACTCAAACAGTGGAAGAGTTGTTACAACAGATGCGACGTCGGTACCAAATATACCAGATGCAACGGCAATGTCAGGAGTCGCGTCAATGTCACCAACCG[C/T]
AGGTGCAAGTCCAGATGCCAGCCCAGAACCCGAATCAGAGTCAGAGTCAGGAGTTCCCAATATTGGCACCGAAGACCCCTGTCAAAATGCTGTCCAGATC
GATCTGGACAGCATTTTGACAGGGGTCTTCGGTGCCAATATTGGGAACTCCTGACTCTGACTCTGATTCGGGTTCTGGGCTGGCATCTGGACTTGCACCT[G/A]
CGGTTGGTGACATTGACGCGACTCCTGACATTGCCGTTGCATCTGGTATATTTGGTACCGACGTCGCATCTGTTGTAACAACTCTTCCACTGTTTGAGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.30% | 14.30% | 2.64% | 9.73% | NA |
| All Indica | 2759 | 74.10% | 24.00% | 0.29% | 1.63% | NA |
| All Japonica | 1512 | 66.90% | 0.10% | 6.48% | 26.52% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 93.90% | 6.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.40% | 0.22% | 0.22% | NA |
| Indica III | 913 | 45.00% | 50.80% | 0.55% | 3.61% | NA |
| Indica Intermediate | 786 | 79.90% | 18.40% | 0.25% | 1.40% | NA |
| Temperate Japonica | 767 | 69.60% | 0.00% | 3.00% | 27.38% | NA |
| Tropical Japonica | 504 | 64.90% | 0.00% | 12.10% | 23.02% | NA |
| Japonica Intermediate | 241 | 62.20% | 0.80% | 5.81% | 31.12% | NA |
| VI/Aromatic | 96 | 66.70% | 3.10% | 16.67% | 13.54% | NA |
| Intermediate | 90 | 85.60% | 11.10% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0118565792 | C -> T | LOC_Os01g33740.1 | missense_variant ; p.Ala898Thr; MODERATE | nonsynonymous_codon ; A898T | Average:21.562; most accessible tissue: Minghui63 root, score: 38.567 | unknown | unknown | TOLERATED | 0.13 |
| vg0118565792 | C -> DEL | LOC_Os01g33740.1 | N | frameshift_variant | Average:21.562; most accessible tissue: Minghui63 root, score: 38.567 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0118565792 | NA | 3.31E-07 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118565792 | NA | 1.09E-07 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118565792 | NA | 6.78E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118565792 | NA | 1.93E-06 | mr1411 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118565792 | NA | 6.58E-06 | mr1560 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118565792 | NA | 1.58E-06 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118565792 | 9.99E-07 | 9.95E-09 | mr1107_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118565792 | NA | 4.26E-06 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118565792 | NA | 3.35E-07 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |