\
| Variant ID: vg0118504134 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 18504134 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, C: 0.09, others allele: 0.00, population size: 96. )
TCCGTAACCCCCCTCCCCTCATTATATTTTTGCTGGCGGTTTTTGCGTATGGCCGCCAGCAAAATTTATAGGGTAACGCCATGAAACATTACTTTTCTAG[C/T]
AGTGTATAAGACTTAGTATATGGTTAGTCCCGCCGAGCTTAATTAGTTGATTACTGTTGGGTATGGGTTATCCATAACCCTGACACATATTACCTTAAAA
TTTTAAGGTAATATGTGTCAGGGTTATGGATAACCCATACCCAACAGTAATCAACTAATTAAGCTCGGCGGGACTAACCATATACTAAGTCTTATACACT[G/A]
CTAGAAAAGTAATGTTTCATGGCGTTACCCTATAAATTTTGCTGGCGGCCATACGCAAAAACCGCCAGCAAAAATATAATGAGGGGAGGGGGGTTACGGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.50% | 39.40% | 0.53% | 0.57% | NA |
| All Indica | 2759 | 90.50% | 8.10% | 0.72% | 0.72% | NA |
| All Japonica | 1512 | 8.90% | 91.10% | 0.00% | 0.07% | NA |
| Aus | 269 | 53.90% | 42.80% | 1.12% | 2.23% | NA |
| Indica I | 595 | 95.30% | 1.80% | 2.52% | 0.34% | NA |
| Indica II | 465 | 82.60% | 15.90% | 0.22% | 1.29% | NA |
| Indica III | 913 | 91.50% | 7.90% | 0.00% | 0.66% | NA |
| Indica Intermediate | 786 | 90.30% | 8.40% | 0.51% | 0.76% | NA |
| Temperate Japonica | 767 | 1.30% | 98.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 14.70% | 85.10% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 20.70% | 79.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 41.10% | 56.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0118504134 | C -> T | LOC_Os01g33615.1 | upstream_gene_variant ; 379.0bp to feature; MODIFIER | silent_mutation | Average:62.59; most accessible tissue: Minghui63 flag leaf, score: 77.828 | N | N | N | N |
| vg0118504134 | C -> T | LOC_Os01g33609.1 | downstream_gene_variant ; 3719.0bp to feature; MODIFIER | silent_mutation | Average:62.59; most accessible tissue: Minghui63 flag leaf, score: 77.828 | N | N | N | N |
| vg0118504134 | C -> T | LOC_Os01g33630.1 | downstream_gene_variant ; 2386.0bp to feature; MODIFIER | silent_mutation | Average:62.59; most accessible tissue: Minghui63 flag leaf, score: 77.828 | N | N | N | N |
| vg0118504134 | C -> T | LOC_Os01g33615-LOC_Os01g33630 | intergenic_region ; MODIFIER | silent_mutation | Average:62.59; most accessible tissue: Minghui63 flag leaf, score: 77.828 | N | N | N | N |
| vg0118504134 | C -> DEL | N | N | silent_mutation | Average:62.59; most accessible tissue: Minghui63 flag leaf, score: 77.828 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0118504134 | NA | 2.84E-21 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118504134 | 4.93E-07 | 4.93E-07 | mr1416_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118504134 | NA | 4.61E-46 | mr1519_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118504134 | NA | 6.66E-08 | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |