\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118424879:

Variant ID: vg0118424879 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 18424879
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTCGATTCGGATTTGGTGTGTGTGAGAATTGTGGATTCAAGTTTGTGTGAGTGCTTGTTGTTGACTTCGTGAAGATTTGTGAGCACTTGCATCATCTC[C/T]
GGGAATTCATTGCTTCATTTGTTACTCTTGGAGGTTGAGGACTCCTAGGCGGCTAGGTGTTGCTCCCGAGCCACCGATCTACTTGTGGTGGCCGGGAGAA

Reverse complement sequence

TTCTCCCGGCCACCACAAGTAGATCGGTGGCTCGGGAGCAACACCTAGCCGCCTAGGAGTCCTCAACCTCCAAGAGTAACAAATGAAGCAATGAATTCCC[G/A]
GAGATGATGCAAGTGCTCACAAATCTTCACGAAGTCAACAACAAGCACTCACACAAACTTGAATCCACAATTCTCACACACACCAAATCCGAATCGAACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.10% 7.30% 3.96% 24.69% NA
All Indica  2759 53.20% 3.60% 4.42% 38.78% NA
All Japonica  1512 84.30% 11.10% 2.65% 1.98% NA
Aus  269 71.70% 0.00% 7.81% 20.45% NA
Indica I  595 57.10% 0.00% 1.34% 41.51% NA
Indica II  465 78.50% 11.80% 4.73% 4.95% NA
Indica III  913 29.50% 2.50% 7.45% 60.57% NA
Indica Intermediate  786 62.80% 2.70% 3.05% 31.42% NA
Temperate Japonica  767 97.50% 0.30% 2.22% 0.00% NA
Tropical Japonica  504 60.30% 30.00% 4.37% 5.36% NA
Japonica Intermediate  241 92.10% 6.20% 0.41% 1.24% NA
VI/Aromatic  96 28.10% 67.70% 2.08% 2.08% NA
Intermediate  90 73.30% 13.30% 2.22% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0118424879 C -> T LOC_Os01g33460.1 upstream_gene_variant ; 566.0bp to feature; MODIFIER silent_mutation Average:32.607; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0118424879 C -> T LOC_Os01g33450-LOC_Os01g33460 intergenic_region ; MODIFIER silent_mutation Average:32.607; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0118424879 C -> DEL N N silent_mutation Average:32.607; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0118424879 NA 5.51E-11 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879 NA 2.60E-09 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879 NA 4.84E-13 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879 NA 7.57E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879 NA 2.22E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879 NA 4.72E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879 NA 1.65E-10 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879 6.41E-06 NA mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879 1.09E-07 NA mr1301 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879 6.35E-06 NA mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879 NA 7.42E-08 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879 NA 2.36E-09 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879 NA 8.08E-06 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879 NA 1.55E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879 NA 5.05E-08 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879 NA 9.91E-09 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879 NA 5.80E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879 NA 2.54E-08 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879 NA 7.98E-06 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879 1.11E-06 NA mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879 1.88E-07 NA mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879 NA 8.12E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251