Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118424879:

Variant ID: vg0118424879 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 18424879
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

TGTTCGATTCGGATTTGGTGTGTGTGAGAATTGTGGATTCAAGTTTGTGTGAGTGCTTGTTGTTGACTTCGTGAAGATTTGTGAGCACTTGCATCATCTC[C/T]
GGGAATTCATTGCTTCATTTGTTACTCTTGGAGGTTGAGGACTCCTAGGCGGCTAGGTGTTGCTCCCGAGCCACCGATCTACTTGTGGTGGCCGGGAGAA

Reverse complement sequence

TTCTCCCGGCCACCACAAGTAGATCGGTGGCTCGGGAGCAACACCTAGCCGCCTAGGAGTCCTCAACCTCCAAGAGTAACAAATGAAGCAATGAATTCCC[G/A]
GAGATGATGCAAGTGCTCACAAATCTTCACGAAGTCAACAACAAGCACTCACACAAACTTGAATCCACAATTCTCACACACACCAAATCCGAATCGAACA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.10%	7.30%	3.96%	24.69%	NA
All Indica	2759	53.20%	3.60%	4.42%	38.78%	NA
All Japonica	1512	84.30%	11.10%	2.65%	1.98%	NA
Aus	269	71.70%	0.00%	7.81%	20.45%	NA
Indica I	595	57.10%	0.00%	1.34%	41.51%	NA
Indica II	465	78.50%	11.80%	4.73%	4.95%	NA
Indica III	913	29.50%	2.50%	7.45%	60.57%	NA
Indica Intermediate	786	62.80%	2.70%	3.05%	31.42%	NA
Temperate Japonica	767	97.50%	0.30%	2.22%	0.00%	NA
Tropical Japonica	504	60.30%	30.00%	4.37%	5.36%	NA
Japonica Intermediate	241	92.10%	6.20%	0.41%	1.24%	NA
VI/Aromatic	96	28.10%	67.70%	2.08%	2.08%	NA
Intermediate	90	73.30%	13.30%	2.22%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0118424879	C -> T	LOC_Os01g33460.1	upstream_gene_variant ; 566.0bp to feature; MODIFIER	silent_mutation	Average:32.607; most accessible tissue: Minghui63 panicle, score: 79.811	N	N	N	N
vg0118424879	C -> T	LOC_Os01g33450-LOC_Os01g33460	intergenic_region ; MODIFIER	silent_mutation	Average:32.607; most accessible tissue: Minghui63 panicle, score: 79.811	N	N	N	N
vg0118424879	C -> DEL	N	N	silent_mutation	Average:32.607; most accessible tissue: Minghui63 panicle, score: 79.811	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0118424879	NA	5.51E-11	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879	NA	2.60E-09	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879	NA	4.84E-13	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879	NA	7.57E-06	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879	NA	2.22E-07	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879	NA	4.72E-07	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879	NA	1.65E-10	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879	6.41E-06	NA	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879	1.09E-07	NA	mr1301	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879	6.35E-06	NA	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879	NA	7.42E-08	mr1489	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879	NA	2.36E-09	mr1546	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879	NA	8.08E-06	mr1805	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879	NA	1.55E-06	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879	NA	5.05E-08	mr1089_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879	NA	9.91E-09	mr1093_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879	NA	5.80E-06	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879	NA	2.54E-08	mr1235_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879	NA	7.98E-06	mr1243_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879	1.11E-06	NA	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879	1.88E-07	NA	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118424879	NA	8.12E-06	mr1482_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251