\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118347734:

Variant ID: vg0118347734 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 18347734
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


TAATACTAGATGATACCCCGCGCGATGCTGCGGAATACTATGTGAAAAAAGTAGTATGATTGAAGGAAAGATATAAAAATAAAGCCAATCTACCAAAGGA[A/G]
TTCTATAGTTTGATTGGTATATAATATGTCTGCCATATAAGCAATCTAACAGGGTCATGTATAAGTTCAAATGACGGTTATGTTGTTCAGAGAGTATATA

Reverse complement sequence

TATATACTCTCTGAACAACATAACCGTCATTTGAACTTATACATGACCCTGTTAGATTGCTTATATGGCAGACATATTATATACCAATCAAACTATAGAA[T/C]
TCCTTTGGTAGATTGGCTTTATTTTTATATCTTTCCTTCAATCATACTACTTTTTTCACATAGTATTCCGCAGCATCGCGCGGGGTATCATCTAGTATTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.90% 2.10% 0.00% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 93.50% 6.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 95.60% 4.40% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 76.80% 23.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0118347734 A -> G LOC_Os01g33290.1 downstream_gene_variant ; 2108.0bp to feature; MODIFIER silent_mutation Average:48.004; most accessible tissue: Callus, score: 83.149 N N N N
vg0118347734 A -> G LOC_Os01g33270-LOC_Os01g33290 intergenic_region ; MODIFIER silent_mutation Average:48.004; most accessible tissue: Callus, score: 83.149 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0118347734 4.10E-09 4.10E-09 mr1008 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118347734 1.00E-09 1.00E-09 mr1009 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118347734 1.32E-07 1.32E-07 mr1014 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118347734 5.66E-06 NA mr1971 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251