\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118269761:

Variant ID: vg0118269761 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 18269761
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGATAGAAATAGCCCCTGAGCGAAAGCTCAAAGGGTGACATGTTATAATATGTATGGAAAACTGAAGATGAATTAAACTTACAGACCAAATGTTTTGT[A/G]
TATGAGCGTCTACTCTTTTACCGACTTCGATCAGTCAGTTTGTTGAGTTATACACTCTCCCTAGCCCCCAGCCTTGTCGTCGGAGAATCGTTCTCAGATG

Reverse complement sequence

CATCTGAGAACGATTCTCCGACGACAAGGCTGGGGGCTAGGGAGAGTGTATAACTCAACAAACTGACTGATCGAAGTCGGTAAAAGAGTAGACGCTCATA[T/C]
ACAAAACATTTGGTCTGTAAGTTTAATTCATCTTCAGTTTTCCATACATATTATAACATGTCACCCTTTGAGCTTTCGCTCAGGGGCTATTTCTATCTAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.60% 24.40% 0.00% 0.00% NA
All Indica  2759 66.10% 33.90% 0.00% 0.00% NA
All Japonica  1512 98.10% 1.90% 0.00% 0.00% NA
Aus  269 35.70% 64.30% 0.00% 0.00% NA
Indica I  595 54.10% 45.90% 0.00% 0.00% NA
Indica II  465 93.80% 6.20% 0.00% 0.00% NA
Indica III  913 57.00% 43.00% 0.00% 0.00% NA
Indica Intermediate  786 69.30% 30.70% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 95.20% 4.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0118269761 A -> G LOC_Os01g33180.1 upstream_gene_variant ; 686.0bp to feature; MODIFIER silent_mutation Average:43.314; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0118269761 A -> G LOC_Os01g33160.1 downstream_gene_variant ; 2563.0bp to feature; MODIFIER silent_mutation Average:43.314; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0118269761 A -> G LOC_Os01g33190.1 downstream_gene_variant ; 2722.0bp to feature; MODIFIER silent_mutation Average:43.314; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0118269761 A -> G LOC_Os01g33160-LOC_Os01g33180 intergenic_region ; MODIFIER silent_mutation Average:43.314; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0118269761 NA 6.17E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118269761 NA 4.25E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118269761 NA 6.60E-08 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118269761 NA 4.37E-06 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118269761 NA 1.67E-10 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118269761 NA 3.69E-09 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118269761 NA 4.01E-06 mr1381_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118269761 NA 3.48E-06 mr1421_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118269761 NA 8.14E-07 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118269761 NA 2.64E-07 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118269761 1.02E-06 1.02E-06 mr1605_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118269761 NA 7.37E-06 mr1661_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118269761 NA 2.67E-10 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118269761 NA 1.73E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118269761 NA 8.05E-06 mr1771_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118269761 NA 2.44E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118269761 NA 1.85E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118269761 NA 2.09E-09 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118269761 NA 7.95E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118269761 NA 4.65E-06 mr1876_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118269761 NA 1.31E-06 mr1901_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118269761 NA 6.00E-07 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118269761 1.23E-07 1.22E-07 mr1953_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251