\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118246218:

Variant ID: vg0118246218 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 18246218
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, T: 0.02, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


CGAGAGAAAACCTTCTCTGGTTGTACCGGTGAAAACCCATACCTCCATCTTCGGGACTTTGAGCTAGTGTGTTCGTGCCTATCCATTGTAGGCATGACAC[A/T]
TGAAACTCTAAAGTGGAAGTTGTTTCCTTTTTTTCTTAGAGAAGAAGTGAAGTAATGGTACACTTTATTTATCAAGAAATTCCACGGTGAATGGGAGGAG

Reverse complement sequence

CTCCTCCCATTCACCGTGGAATTTCTTGATAAATAAAGTGTACCATTACTTCACTTCTTCTCTAAGAAAAAAAGGAAACAACTTCCACTTTAGAGTTTCA[T/A]
GTGTCATGCCTACAATGGATAGGCACGAACACACTAGCTCAAAGTCCCGAAGATGGAGGTATGGGTTTTCACCGGTACAACCAGAGAAGGTTTTCTCTCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.70% 24.90% 0.61% 10.81% NA
All Indica  2759 46.20% 34.70% 1.01% 18.09% NA
All Japonica  1512 97.90% 1.90% 0.00% 0.13% NA
Aus  269 35.30% 64.70% 0.00% 0.00% NA
Indica I  595 12.60% 46.20% 1.68% 39.50% NA
Indica II  465 68.60% 6.70% 1.51% 23.23% NA
Indica III  913 53.70% 43.40% 0.44% 2.52% NA
Indica Intermediate  786 49.60% 32.60% 0.89% 16.92% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 95.00% 4.80% 0.00% 0.20% NA
Japonica Intermediate  241 97.90% 1.70% 0.00% 0.41% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 74.40% 13.30% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0118246218 A -> T LOC_Os01g33136.1 upstream_gene_variant ; 498.0bp to feature; MODIFIER silent_mutation Average:51.037; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 N N N N
vg0118246218 A -> T LOC_Os01g33142.1 downstream_gene_variant ; 494.0bp to feature; MODIFIER silent_mutation Average:51.037; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 N N N N
vg0118246218 A -> T LOC_Os01g33136-LOC_Os01g33142 intergenic_region ; MODIFIER silent_mutation Average:51.037; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 N N N N
vg0118246218 A -> DEL N N silent_mutation Average:51.037; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0118246218 NA 6.00E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118246218 NA 1.93E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118246218 NA 5.70E-06 mr1127_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118246218 NA 2.86E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118246218 NA 2.59E-08 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118246218 NA 4.97E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118246218 NA 3.13E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118246218 NA 1.25E-06 mr1415_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118246218 NA 8.11E-08 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118246218 NA 1.17E-10 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118246218 NA 1.08E-07 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118246218 NA 7.20E-06 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118246218 3.45E-06 3.45E-06 mr1605_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118246218 NA 8.45E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118246218 NA 8.56E-08 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118246218 NA 5.33E-06 mr1763_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118246218 NA 8.29E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118246218 NA 1.76E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118246218 NA 3.10E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118246218 NA 8.47E-10 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118246218 NA 5.20E-07 mr1876_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118246218 4.11E-07 5.61E-09 mr1901_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118246218 NA 4.52E-07 mr1901_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118246218 NA 3.85E-07 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118246218 8.31E-07 8.27E-07 mr1953_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251