\
| Variant ID: vg0118246218 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 18246218 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, T: 0.02, others allele: 0.00, population size: 241. )
CGAGAGAAAACCTTCTCTGGTTGTACCGGTGAAAACCCATACCTCCATCTTCGGGACTTTGAGCTAGTGTGTTCGTGCCTATCCATTGTAGGCATGACAC[A/T]
TGAAACTCTAAAGTGGAAGTTGTTTCCTTTTTTTCTTAGAGAAGAAGTGAAGTAATGGTACACTTTATTTATCAAGAAATTCCACGGTGAATGGGAGGAG
CTCCTCCCATTCACCGTGGAATTTCTTGATAAATAAAGTGTACCATTACTTCACTTCTTCTCTAAGAAAAAAAGGAAACAACTTCCACTTTAGAGTTTCA[T/A]
GTGTCATGCCTACAATGGATAGGCACGAACACACTAGCTCAAAGTCCCGAAGATGGAGGTATGGGTTTTCACCGGTACAACCAGAGAAGGTTTTCTCTCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.70% | 24.90% | 0.61% | 10.81% | NA |
| All Indica | 2759 | 46.20% | 34.70% | 1.01% | 18.09% | NA |
| All Japonica | 1512 | 97.90% | 1.90% | 0.00% | 0.13% | NA |
| Aus | 269 | 35.30% | 64.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 12.60% | 46.20% | 1.68% | 39.50% | NA |
| Indica II | 465 | 68.60% | 6.70% | 1.51% | 23.23% | NA |
| Indica III | 913 | 53.70% | 43.40% | 0.44% | 2.52% | NA |
| Indica Intermediate | 786 | 49.60% | 32.60% | 0.89% | 16.92% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.00% | 4.80% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 97.90% | 1.70% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 13.30% | 1.11% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0118246218 | A -> T | LOC_Os01g33136.1 | upstream_gene_variant ; 498.0bp to feature; MODIFIER | silent_mutation | Average:51.037; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 | N | N | N | N |
| vg0118246218 | A -> T | LOC_Os01g33142.1 | downstream_gene_variant ; 494.0bp to feature; MODIFIER | silent_mutation | Average:51.037; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 | N | N | N | N |
| vg0118246218 | A -> T | LOC_Os01g33136-LOC_Os01g33142 | intergenic_region ; MODIFIER | silent_mutation | Average:51.037; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 | N | N | N | N |
| vg0118246218 | A -> DEL | N | N | silent_mutation | Average:51.037; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0118246218 | NA | 6.00E-07 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118246218 | NA | 1.93E-06 | mr1115_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118246218 | NA | 5.70E-06 | mr1127_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118246218 | NA | 2.86E-06 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118246218 | NA | 2.59E-08 | mr1274_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118246218 | NA | 4.97E-08 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118246218 | NA | 3.13E-07 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118246218 | NA | 1.25E-06 | mr1415_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118246218 | NA | 8.11E-08 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118246218 | NA | 1.17E-10 | mr1537_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118246218 | NA | 1.08E-07 | mr1562_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118246218 | NA | 7.20E-06 | mr1566_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118246218 | 3.45E-06 | 3.45E-06 | mr1605_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118246218 | NA | 8.45E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118246218 | NA | 8.56E-08 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118246218 | NA | 5.33E-06 | mr1763_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118246218 | NA | 8.29E-08 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118246218 | NA | 1.76E-07 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118246218 | NA | 3.10E-07 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118246218 | NA | 8.47E-10 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118246218 | NA | 5.20E-07 | mr1876_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118246218 | 4.11E-07 | 5.61E-09 | mr1901_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118246218 | NA | 4.52E-07 | mr1901_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118246218 | NA | 3.85E-07 | mr1915_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118246218 | 8.31E-07 | 8.27E-07 | mr1953_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |