\
| Variant ID: vg0118245400 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 18245400 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 78. )
GGGAAAGCTCTGGAGGAGTGCCCGGAAGTTTGGCGCTTATCCGACTTCTACCTCGACGAGTGTAGCTTCCTAGGAGGAATTCTGGAGGAGTACCGGAGCT[A/G]
TCGGTACACTCTGCTCCGGGTTCGGAGAACTTCTATAAAGTAAGCATTTGTGTTCCTTTCTTATGTTATTTAATTACTTTGTCTAAGTAAGATAAATTTC
GAAATTTATCTTACTTAGACAAAGTAATTAAATAACATAAGAAAGGAACACAAATGCTTACTTTATAGAAGTTCTCCGAACCCGGAGCAGAGTGTACCGA[T/C]
AGCTCCGGTACTCCTCCAGAATTCCTCCTAGGAAGCTACACTCGTCGAGGTAGAAGTCGGATAAGCGCCAAACTTCCGGGCACTCCTCCAGAGCTTTCCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.80% | 35.50% | 11.43% | 8.27% | NA |
| All Indica | 2759 | 69.80% | 2.80% | 15.22% | 12.25% | NA |
| All Japonica | 1512 | 6.60% | 91.60% | 0.79% | 0.99% | NA |
| Aus | 269 | 22.70% | 29.00% | 35.32% | 13.01% | NA |
| Indica I | 595 | 61.80% | 1.00% | 15.97% | 21.18% | NA |
| Indica II | 465 | 89.50% | 4.30% | 3.66% | 2.58% | NA |
| Indica III | 913 | 66.00% | 1.40% | 22.23% | 10.30% | NA |
| Indica Intermediate | 786 | 68.40% | 4.70% | 13.36% | 13.49% | NA |
| Temperate Japonica | 767 | 4.60% | 95.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.20% | 93.30% | 2.18% | 2.38% | NA |
| Japonica Intermediate | 241 | 22.40% | 75.90% | 0.41% | 1.24% | NA |
| VI/Aromatic | 96 | 2.10% | 94.80% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 31.10% | 54.40% | 11.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0118245400 | A -> G | LOC_Os01g33142.1 | downstream_gene_variant ; 1312.0bp to feature; MODIFIER | silent_mutation | Average:34.01; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg0118245400 | A -> G | LOC_Os01g33136.1 | intron_variant ; MODIFIER | silent_mutation | Average:34.01; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg0118245400 | A -> DEL | N | N | silent_mutation | Average:34.01; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0118245400 | NA | 3.92E-15 | mr1228 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118245400 | NA | 1.76E-19 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118245400 | NA | 4.90E-06 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118245400 | NA | 4.08E-15 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118245400 | 6.36E-07 | NA | mr1363_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118245400 | NA | 5.69E-06 | mr1363_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118245400 | NA | 3.15E-44 | mr1519_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118245400 | NA | 2.64E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118245400 | NA | 4.03E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118245400 | NA | 1.75E-10 | mr1893_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |