\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118219645:

Variant ID: vg0118219645 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 18219645
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAGGCTGAGGCAGAGGTGGCAGAACGAAGAGGATATGGACGGGGCGGCGGCGAGTCTCTATGGCAGCCATCGTGTTCCTCAGTCCTCCCATGGCTAGCA[T/C]
GGCTCCGACCCCTCTCTTTGCGACGCCGGTCAAGCTTTGTGCCGCCGACGTATAGCTCCTCCCTCGCCGGTCGAGCCCGTCGCACCGTGGAGAGGAGAGG

Reverse complement sequence

CCTCTCCTCTCCACGGTGCGACGGGCTCGACCGGCGAGGGAGGAGCTATACGTCGGCGGCACAAAGCTTGACCGGCGTCGCAAAGAGAGGGGTCGGAGCC[A/G]
TGCTAGCCATGGGAGGACTGAGGAACACGATGGCTGCCATAGAGACTCGCCGCCGCCCCGTCCATATCCTCTTCGTTCTGCCACCTCTGCCTCAGCCTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.40% 14.10% 0.42% 0.00% NA
All Indica  2759 99.00% 1.00% 0.04% 0.00% NA
All Japonica  1512 65.90% 33.00% 1.06% 0.00% NA
Aus  269 77.30% 22.30% 0.37% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 2.00% 0.13% 0.00% NA
Temperate Japonica  767 93.00% 6.30% 0.78% 0.00% NA
Tropical Japonica  504 25.80% 72.80% 1.39% 0.00% NA
Japonica Intermediate  241 63.90% 34.90% 1.24% 0.00% NA
VI/Aromatic  96 33.30% 65.60% 1.04% 0.00% NA
Intermediate  90 77.80% 21.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0118219645 T -> C LOC_Os01g33100.1 upstream_gene_variant ; 4562.0bp to feature; MODIFIER silent_mutation Average:85.046; most accessible tissue: Zhenshan97 young leaf, score: 94.111 N N N N
vg0118219645 T -> C LOC_Os01g33100-LOC_Os01g33110 intergenic_region ; MODIFIER silent_mutation Average:85.046; most accessible tissue: Zhenshan97 young leaf, score: 94.111 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0118219645 T C 0.01 0.01 0.01 0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0118219645 NA 7.21E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219645 NA 1.21E-18 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219645 NA 1.88E-13 mr1398_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219645 NA 2.51E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219645 NA 6.85E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219645 NA 5.84E-16 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219645 NA 6.49E-07 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219645 NA 1.09E-08 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219645 NA 5.31E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219645 NA 1.47E-07 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219645 NA 2.52E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219645 NA 1.47E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219645 NA 1.90E-24 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251