Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118219073:

Variant ID: vg0118219073 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 18219073
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GCGGGGCGAGGCGGCAGAGGAGGAGGTCTGGCGGTGGCGACGGGGGAGAAGGGGACTCCCCACGCCAGCTACAACTCCAGCCAGCGGAAGAACCGCGAGT[T/C]
GCGCCGCTTCATGGCCCTCCCCATGCCAACGCCGCCACAGCAAGCCACCACCGCCAGACGCCCCGAGCTCCTGTGAGCTCACCGGCGACGGCGACTGCCA

Reverse complement sequence

TGGCAGTCGCCGTCGCCGGTGAGCTCACAGGAGCTCGGGGCGTCTGGCGGTGGTGGCTTGCTGTGGCGGCGTTGGCATGGGGAGGGCCATGAAGCGGCGC[A/G]
ACTCGCGGTTCTTCCGCTGGCTGGAGTTGTAGCTGGCGTGGGGAGTCCCCTTCTCCCCCGTCGCCACCGCCAGACCTCCTCCTCTGCCGCCTCGCCCCGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.30% 34.00% 0.32% 0.38% NA
All Indica  2759 98.10% 1.60% 0.11% 0.18% NA
All Japonica  1512 8.50% 91.40% 0.00% 0.13% NA
Aus  269 75.50% 16.00% 4.46% 4.09% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 96.60% 3.20% 0.22% 0.00% NA
Indica III  913 99.60% 0.30% 0.00% 0.11% NA
Indica Intermediate  786 96.30% 2.90% 0.25% 0.51% NA
Temperate Japonica  767 4.60% 95.40% 0.00% 0.00% NA
Tropical Japonica  504 6.70% 92.90% 0.00% 0.40% NA
Japonica Intermediate  241 24.50% 75.50% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 48.90% 51.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0118219073 T -> DEL N N silent_mutation Average:88.426; most accessible tissue: Zhenshan97 young leaf, score: 95.805 N N N N
vg0118219073 T -> C LOC_Os01g33100.1 upstream_gene_variant ; 3990.0bp to feature; MODIFIER silent_mutation Average:88.426; most accessible tissue: Zhenshan97 young leaf, score: 95.805 N N N N
vg0118219073 T -> C LOC_Os01g33100-LOC_Os01g33110 intergenic_region ; MODIFIER silent_mutation Average:88.426; most accessible tissue: Zhenshan97 young leaf, score: 95.805 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0118219073 T C 0.0 0.0 0.0 0.0 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0118219073 2.27E-06 NA mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219073 1.05E-06 NA mr1009 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219073 3.74E-06 3.74E-06 mr1009 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219073 2.06E-06 NA mr1015 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219073 NA 3.58E-19 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219073 NA 5.09E-44 mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219073 NA 9.19E-16 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219073 NA 2.43E-18 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219073 NA 1.64E-49 mr1519 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219073 NA 1.88E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219073 NA 1.75E-07 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219073 NA 6.22E-06 mr1064_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219073 NA 1.56E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219073 NA 5.00E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219073 NA 3.29E-09 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219073 NA 2.15E-51 mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219073 NA 1.18E-10 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219073 NA 2.53E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219073 NA 9.98E-08 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219073 NA 3.20E-06 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219073 NA 1.48E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251